تاثیر تمرین تناوبی شدید و عسل آویشن بر بیان ژن شاخص‌های آپوپتوزی بافت قلب و شاخص مقاومت به انسولین در رت‌های دیابتی نوع دو

نوع مقاله : مقاله پژوهشی

نویسندگان

1 هیات علمی دانشگاه آزاد اسلامی واحد داریون

2 گروه تخصصی تربیت بدنی و علوم ورزشی،دانشگاه آزاد اسلامی،واحد علوم و تحقیقات، تهران، ایران.

3 هیات علمی دانشگاه آزاد اسلامی واحد علوم و تحقیقات

4 گروه فیزیولوژی، دانشکده تربیت بدنی و علوم ورزشی، دانشگاه آزادواحد علوم تحقیقات، تهران، ایران

چکیده

زمینه و هدف: دیابت نوع 2 شایع ترین بیماری غدد درون ریز است که می‌تواند باعث آسیب و مرگ سلولی یا آپوپتوز شود. هدف پژوهش حاضر مطالعه تغییرات بیان ژن آپوپتوزی و آنتی‌آپوپتوزی بافت قلب و شاخص مقاومت ‌به ‌انسولین پس از تمرین تناوبی شدید و مصرف عسل آویشن در رت‌های دیابتی نوع دو بود.
روش کار: جامعه آماری را موش‌های صحرایی نر تشکیل می دادند که پس از 20 هفته تغذیه با رژیم پرچرب و با تزریق STZ دیابتی شدند. موش‌ها در چهار گروه کنترل دیابتی شش، تمرین تناوبی هشت، عسل آویشن شش، تمرین تناوبی‌ و عسل آویشن هشت سرگروه‌بندی شدند و هشت هفته تحت تمرین تناوبی،پنج جلسه در هفته با تناوب شدید دو دقیقه‌ای با دو تا هشت تناوب و 80-90% vo2max و استراحت یک دقیقه‌ای با 50 تا 56% vo2max قرار گرفتند. عسل آویشن به صورت گاواژ، سه گرم برکیلوگرم پنج روز در هفته داده شد. گلوکز، انسولین و بیان ژن Bax و Bcl2 و BAX/Bcl2 اندازه گیری شد. تحلیل آماری با استفاده آزمون تحلیل واریانس دو عاملی و تعیین اندازه اثر و تعقیبی بن فرونی انجام شد.
یافته ها: HIIT به کاهش معنی‌دار گلوکز و شاخص مقاومت به انسولین منجر شد. تمرین تناوبی و مصرف عسل -آویشن هم چنین به کاهش بیان Bax و افزایش بیان Bcl2 منجر گردید(P<0.05). تمرینات تناوبی همراه با مصرف عسل ‌آویشن در رت‌های دیابتی منجر به بهبود سطوح گلوکز و انسولین و کاهش شاخص مقاومت به انسولین و نیز باعث کاهش بیان Bax و افزایش Bcl2 در سلول های قلبی نسبت به گروه کنترل شد(P<0.05).
 نتیجه گیری: تمرین تناوبی و مصرف عسل آویشن به بهبود پروفایل گلایسمیک و هم چنین تغییرات مثبتی در بیان ژن‌های قلبی و ضد آپوپتوزی منجر می‌شود.

کلیدواژه‌ها


عنوان مقاله [English]

The effect of HIIT and thyme honey on gene expression of cardiac tissue apoptotic indices and insulin resistance index in type 2 diabetic rats

نویسندگان [English]

  • bahareh behaeen 1
  • Hossein َAbedntanzi 2
  • mandana gholami 3
  • farshad ghazalian 4
1 Department of Islamic Azad University, Dariun Branch, Dariun, Iran
2 Department of physical education and sport science, Science and research branch, Islamic Azad University, Tehran, Iran.
3 Department of physical education and sport science, Science and research branch, Islamic Azad University, Tehran, Iran.
4 Department of Physiology, Faculty of Physical Education and Sport Sciences, Azad University, Research Sciences Branch, Tehran, Iran
چکیده [English]

Inroduction & Objective: Type 2 diabetes is the most common endocrine disease that can cause damage and cell death or apoptosis. The aim of this study was to investigate the expression of apoptotic and anti-apoptotic gene of heart tissue and insulin resistance index after intense intermittent exercise and consumption of thyme honey in diabetic type 2 rats.
Materials and Methods: The statistical population consisted of rats. After 20 weeks of high fat diet and injection of STZ became diabetic. Rats in 4 groups: control(n=6),HIIT(n= 8),thyme honey(n= 6),HIIT-thyme honey (n=8) trained HIIT for eight weeks, five sessions per week with intense 2-minute intense alternation with 2 to 8 alternations and with 80 to 90% vo2max and one-minute rest alternation with 50 to 56% vo2max.Thyme honey was given by gavage at a rate of 3g/kg 5days a week. Glucose, insulin and expression of Bax and Bcl2 genes and their ratio was calculated. Statistical analysis was performed using two-factor analysis of variance test and determining the effect size and Bonfroni post hoc.
Results: HIIT and thyme honey decreased Bax gene expression and increased Bcl2 expression in heart cells (P<0.05). HIIT and thyme honey in diabetic rats led to improved glucose and insulin levels and decreased insulin resistance index. It also decreased the expression of Bax gene and increased the expression of Bcl2 (P<0.05).
Conclusion: HIIT with thyme honey led to improved glycemic profile and changes in glucose and insulin levels, as well as positive and appropriate changes in the expression of cardiac and anti-apoptotic genes.
 

کلیدواژه‌ها [English]

  • HIIT
  • Type 2 diabetes
  • Thyme Honey
  • Apoptosis
  • Insulin Resistance Index

مقدمه

 

دیابت نوع دو شایع ترین بیماری درون ریز است که به دلیل عدم تحمل گلوکز در اثر برهم خوردن تعادل بین ذخایر و تقاضای انسولین رخ می دهد. این بیماری متابولیکی با هیپرگلیسمی ناشی از نقصان ترشح انسولین، مقاومت به انسولین و یا ترکیبی ازهر دو مشخص می‌شود و بــا افــزایش گلــوکز خــون، اخــتلال در متابولیســم کربوهیدرات و لیپید همراه می باشد(53). تخمین زده می‌شـود تعداد افراد دیابتی در دنیا از 17 میلیـون در سـال 2000، به 366 میلیون در سال 2030 برسـد. در افراد مقاوم به انسولین سلول‌های بدن به صورت طبیعی به انسولین پاسخ نداده و گلوکز نمی‌تواند به آسانی به درون سلول جریان یابد. این بیماری متابولیسم درون سلولی اغلب بافت‌ها از جمله قلب و کبد را متاثر می‌کند و به عنوان یکی از عوامل اصلی شیوع اختلالات قلبی و عروقی نیز محسوب می‌شود. حفظ ثبات سطح گلوکز خون توسط برداشت و ذخیره‌سازی گلوکز از وظایف کبد به ‌شمار می‌رود. محل ترشح انسولین سلول‌های بتای پانکراس اسـت. به دلیـل ایـن که اندام‌های اصلی بدن بـرای مصـرف سـوخت خـود کـه عمدتاً گلوکز می‌باشد به هورمون انسولین نیاز دارنـد، ایـن کاهش منجر به کاهش مصـرف گلـوکز توسـط انـدام‌هـا و افزایش قند خون و گلوکونئوژنز مـی‌شـود لذا کـاهش تولیـد انسولین مهم ترین مشخصـه‌ی بیمـاری دیابـت مـی‌باشـد(9). افزایش قند خـون از طریـق افزایش تولید محصولات نهایی گلیکوزیله پیشرفته باعث تسهیل در تولید رادیکال های آزاد، از طریق اخـتلال در تولید رادیکال های درون زاد آزاد مثـل سـوپر اکسید دیسموتاز و کاتالاز می‌گردد که به آسیب سلول منجر می‌شود(27). دیابت هم چنین می‌تواند باعث صـدمه بـافتی و مـرگ سلولی یا آپوپتوز شود. آپوپتوز مرگ برنامـه ریـزی و بـه طور کامل حفاظت شده سلولی می‌باشد که نقش مهمی را در رشد و نمو اندام ها، هومئوستاز و انهدام سلول‌هـای فرسوده ایفا می‌کند(13). تحقیقات نشان مـی‌دهنـد کـه نقص در این مسیر می‌توانـد باعـث تجمـع سـلول‌هـای جهش یافته و در نهایت مرگ بیمار شود(21). تحقیقات نشان‌دهنده افزایش شیوع آپوپتوز در کبـد نمونـه‌هـای دیـــــابتی القـــــا شـــــده به‌وســـــیله آلوکســـــان(ALX) در مدل حیوانی هستند(28). برخی پژوهش‌ها گزارش کـرده‌انـد فعالیـت ورزشـی شــدید موجــب آپوپتــوز لنفوســیت روده‌ای مــوش آزمایشـگاهی مـی‌شـود امـا دویـدن اختیـاری بـر روی تردمیل آپوپتوز را کاهش می‌دهد، درحالی کـه تمـرین ورزشی اجباری سطوح اکسیدان‌ها را افـزایش مـی‌دهـد(41)، بنابراین تأثیر فعالیت ورزشی بر القا یا مهار آپوپتوز هنـوز مـورد تردیـد اسـت. یکـی از راه هـای درمـان و پیشگیری، فعالیت بدنی به شکل منظم بـرای بیمـاران می باشد. اما این که چه ورزشی و بـا چـه نـوع پروتکلـی، سوالی اسـت کـه محققـین همیشـه در پـی کشـف آن هستند. با توجه به نقش انجام تمرینات و فعالیت های ورزشی در پیشگیری و کنترل چاقی و دیابت، اتخاذ شیوه‌های مختلف تمرینی برای پیشگیری و کاهش شیوع چاقی و نیز کمک به کاهش روند چاقی و عوارض ناشی از آن مانند بیماری‌های کاردیومتابولیک مانند کبد چرب و دیابت و غیره در جامعه ضرورت پیدا می‌کند. تمرین استقامتی با حجم بالا کنترل قند خون را در دیابت نوع دو بهبود می‌بخشد، اما بسیاری از افراد "کمبود وقت" را به عنوان مانعی برای مشارکت منظم ذکر می‌کنند. تمرین تناوبی با شدت بالا(HIT) در نهایت یک روش با زمان کارآمد برای ایجاد سازگاری‌های فیزیولوژیکی می‌باشد، اما در مورد تأثیر HIT در دیابت نوع دو کمتر شناخته شده است. تمرینات تناوبی شدید که معمولاً با شدت های بالاتر از 90 درصد حداکثر ضربان قلب و دوره استراحت‌های کم و مدت‌ زمان تمرینی کمتر از 20 دقیقه انجام می‌گیرد، با به کارگیری و درگیر کردن بهتر و بیشتر تارهای عضلانی و فراخوانی قوی تر ارگان های سوخت و سازی و متابولیکی می تواند از طریق سازوکار سلولی مولکولی، متابولیسم کل بدن را در جهت مثبت تحت تأثیر قرار دهد. از این رو با انجام تمرینات تناوبی شدید، همان طور که پیش‌تر ذکر شد، عضلات بیشتری درگیر خواهد بود لذا در پاسخ به درگیری بیشتر عضلات اسکلتی، میزان مایوکین های ترشح یافته از عضلات اسکلتی افزایش می‌یابد و با فعال کردن متابولیسم عضلانی بسیاری از مسیرهای مربوط به متابولیسم چربی و جذب گلوکز خون را افزایش و باعث بالا رفتن هرچه بهتر متابولیسم می شود(8). با توجه به تولید رادیکـال هـای آزاد توسـط دیابـت و فعالیت ورزشی و نهایتاً ایجاد آپوپتوز یکی از مواردی که توجه محققین را به خود جلـب کـرده اسـت یـافتن راهکارهایی برای کاهش عواقـب منفـی ناشـی از دیابـت و تولید رادیکال‌های آزاد است. امروزه استفاده از گیاهان دارویی و عصاره ها برای درمان بیماری ها افزایش یافته است. گیاهـان دارویـی و مشتقات آن ها اگرچه از دیرباز در درمان دیابت قندی و عوارض ناشی از آن مطرح بـوده انـد، ولـی در مـورد اثر بخـشی قطعـی بسیاری از آن ها تاکنون شواهد معتبری یافت نـشده اسـت. در همین زمینـه، مصـرف عوامل آنتی‌اکسیدانی می‌تواند موثر باشد. محققان زیادی در سراسر دنیا در تلاش هستند تا با استفاده از روش‌های گوناگون از بیماری دیابت پیشگیری کنند یا آن را درمان کنند و یا عوارض بیماری دیابت را کاهش دهند. از طرفی در طب سنتی برای پیشگیری و درمان بیماری‌های متابولیک ازجمله دیابت و کبد چرب از داروهای گیاهی و سنتی استفاده می‌شود(31،51). در این مورد مطالعات نشان داده، عسل آویشن با توجه به خواصی که دارد در تنظیم قند خون به عنوان یک گیاه ضد دیابت نقش مهمی ایفا می‌کند(46 ،6). عسل آویشن دارویی طبیعی است که از گذشته های دور استفاده شده و کاربرد فراوانی دارد. پژوهش ها درباره عسل حاکی از این است که عسل اثرات ضد دیابتی را در مدل‌های حیوانی گرفته تا آزمایشات بالینی نشان داده و محققان از آن به عنوان یک عامل ضد دیابتی بالقوه استفاده کرده اند. دوزهای آزمایش شده عسل تانگو مالزی مانند 0.2، 1.2 و 2.4 گرم بر کیلوگرم در روز اثر آنتی اکسیدانی قابل توجهی را نشان می‌دهد که باعث اثرات کاهش دهنده قند خون در موش های صحرایی دیابتی شده با استرپتوزوتوسین شده است(15). یافته‌های پژوهشی حاکی از این است که عسل اثرات تعدیل کننده‌ای بر استرس اکسیداتیو و هایپرگلیسیمی نشان می‌دهد و فعالیت آنتی اکسیدانی آن برای بهبود دیابت به خوبی نشان داده شده است(16،17). لذا در این مطالعه در نظر است تاثیرات تمرینی تناوبی هوازی شدید به همراه عسل آویشن بر شاخص‌های پرو و آنتی آپوپتوتیک بافت قلبی موش‌های دیابتی نوع دو گزارش گردد تا شاید بتوان از اثر بخشی و نقش آنتی اکسیدانی و ضد التهابی عسل آویشن در کنار طراحی برنامه ورزشی تناوبی متناسب با رژیم غذایی برای دیابتی‌ها استفاده کرد. امید است نتایج حاصل از این پژوهش در علوم پزشکی و ورزشی پس از مطالعات انسانی مشابه به عنوان راهی نجات بخش در بهبود عوارض ناشی از دیابت مانند قلب دیابتی و آسیب‌های قلبی و کبدی مورد استفاده قرار گیرد.

مواد و روش‌ها‌‌‌

جامعه آماری پژوهش حاضر را موش‌های صحرایی نر تشکیل می‌دهند و نمونه‌های پژوهش36 سر رت نر نژاد ویستار جوان با دامنه سنی 35 تا 45 روز و میانگین وزنی 10±110 گرم بودند. پس از دو هفته آشنایی با محیط آزمایشگاه و رسیدن به وزن میانگین 30± 170 گرم تحت رژیم پر چرب قرار گرفتند. پس از 20 هفته(5 ماه) تغذیه با رژیم پرچرب و دسترسی آزاد به مواد غذایی و آب ، به چهار گروه کنترل دیابتی(8 سر)، تمرین تناوبی(10سر)، عسل آویشن(8 سر)، تمرین تناوبی و عسل آویشن(10 سر) تقسیم شدند که در پایان پروتکل 28 سر در چهار گروه کنترل دیابتی(6 سر)، تمرین تناوبی(8سر)،عسل آویشن(6 سر)، تمرین تناوبی و عسل آویشن(8 سر) باقی ماندند.

شیوه نگهداری موش های صحرایی

 برای نگهداری موش‌های صحرایی از قفس‌های جنس پلی‌کربنات شفاف با قابلیت اتوکلاو استفاده شد. دمای مطلوب محل نگهداری حیوانات 20 تا 24 درجه سانتی‌گراد و رطوبت نسبی حدود 55 تا 65 درصد بود. چرخه روشنایی نیز هر 12 ساعت یک بار به طور دقیق توسط تنظیم کننده الکترونیکی نور سالن نگهداری حیوانات آزمایشگاهی رعایت شد. جهت تغذیه موش‌های صحرایی از رژیم پر چرب استاندارد استفاده گردید. دسترسی موش‌های صحرایی به غذا به صورت نامحدود بود و آب در بطری‌های500 میلی‌لیتری در تمامی قفس‌ها وجود داشت.

روش چاق کردن رت ها با رژیم پر چرب

برای این منظور، پس از آشنا سازی و سازگاری با محیط جدید، تمامی رت‌ها به مدت 20 هفته(5 ماه) تحت رژیم غذایی پرچرب تهیه شده توسط پژوهشکده زیست فناوری رویان قرار گرفتند که شامل 45 درصد انرژی کل از چربی مشتق شده از روغن حیوانی(حاوی24 گرم چربی، 24 گرم پروتئین و 41 گرم کربوهیدرات در هر 100 گرم می‌باشد). رژیم پر چرب 45 درصد به مدت 3 ماه و رژیم پر چرب 60 درصد به مدت 2 ماه داده شد(جدول 1)(60،61).

روش دیابتی کردن رت ها از طریق تزریق استرپتوزتوسین(STZ )

برای القای دیابت از رژیم غذایی پر چرب به مدت20 هفته و سپس تزریق محلول تازه تهیه شده از STZ در سرم فیزیولوژیکی قابل تزریق و به صورت داخل صفاقی(25 میلی گرم/کیلوگرم) استفاده شد. یک هفته پس از تزریق، گلوکز خون ناشتایی با ایجاد جراحت کوچک در دم رت‌ها یک قطره خون بر روی نوار گلوکومتری قرارگرفته و توسط دستگاه گلوکومتر نوار خوانده شد و اندازه گیری و قند خون بین 150 تا 400 میلی گرم/ دسی لیتر به عنوان معیاری برای اطمینان از ابتلای رت‌ها به دیابت درنظر گرفته شد. برای اطمینان بیشتر از دیابتی شدن موش‌ها و دقت کار از 10 سر موش به طور تصادفی خون گیری از دم به عمل آمد و گلوکز و انسولین و شاخص مقاومت به انسولین و نیمرخ های چربی آن ها اندازه گیری و اطلاعات آن در جداول آمده است(22،42،52).

آماده سازی و مصرف عسل آویشن

 به میزان 3 کیلوگرم از این گیاه آویشن از مزارع شیراز تهیه و در ترکیب آب مقطر ریخته شد. سپس این عصاره پس از 48 ساعت ماندن در دستگاه شیکر طی پس از 48 ساعت از طریق غربال، دوبار از صافی رد گردید. در نهایت این عصاره فیلتر شده از طریق تبخیر در دمای 358 درجه سانتی‌گراد به یک خمیر غلیظ تبدیل شد. عصاره آبی آویشن در آب حل شده و در اختیار زنبورها در کندو قرار داده و عسل آویشن شیرازی خالص استحصال گردد. سپس عصاره عسل آویشن به صورت گاواژ طبق پروتکل زیر به موش ها داده شد(57، 38). در طی دوره آزمایش به موش های گروه عسل آویشن، و گروه عسل آویشن و تمرین تناوبی، عصاره عسل آویشن با دوز 3 گرم بر کیلوگرم(3g/kg) رقیق شده در آب مقطر و به روش گاواژ خورانده شد(26،45،47).

آزمون تمرین دویدن با سرعت حداکثر برای تعیین شدت تمرین(MERT)

برای تعیین سرعت حداکثر از پروتکل رودریگرز و همکاران(2007) استفاده شد. برای اندازه گیری حداکثر اکسیژن مصرفی(VO2max) به دلیل عدم دسترسی به ابزار مستقیم( مانند دستگاه آنالیز گازهای تنفسی) و با توجه به پژوهش های انجام شده، پروتکل غیرمستقیم با دقت زیاد مورد استفاده قرار گرفت. به این ترتیب که هر دو هفته یک بار موش‌ها در یک وهله تمرینی پس از پنج دقیقه گرم کردن با سرعت ده متر در دقیقه سپس با سرعت 15 متر در دقیقه به مدت دو دقیقه شروع به دویدن کردند و هر سه دقیقه سه متر در دقیقه به سرعت افزوده شد تا این که هر کدام از موش‌ها که نتوانستند ادامه دهند و روی شوکر باقی ماندند و به واماندگی رسیدند، آن سرعت به عنوان سرعت حداکثر آنان در نظر گرفته می‌شد و سرعت حداکثر برای شدت تمرین بین 80 تا 95 درصد MERT در نظر گرفته شد وخلاصه پروتکل در جدول 2 آمده است. با توجه به پژوهش های صورت گرفته، ارتباط بالایی بین سرعت نوارگردان و VO2max رت ها وجود دارد.(r=0.94-0.98.p<0.05 ) از این رو می‌توان با توجه به سرعت دویدن، میزان VO2max  رت‌ها را برآورد کرد(50، 33 ،25 ،7).

پروتکل تمرین تناوبی

برنامه هشت هفته تمرین هوازی، پنج جلسه در هفته با افزایش تدریجی تناوب شدید از سرعت 22 الی 38 متر بر دقیقه(80 تا 90 درصد Vo2max) و تناوب استراحت با سرعت 16 تا 22 متر در دقیقه(50 تا 56 درصد vo2max ) زمان 15 الی 34 دقیقه به صورت دویدن روی تردمیل انجام شد، به طوری که زمان دویدن از 16 دقیقه در هفته اول، به 34 دقیقه در هفته هشتم افزایش یافت. رت‌ها یک هفته قبل از شروع پروتکل به منظور آشنایی با تردمیل سه روز در هفته با سرعت پنج متر در دقیقه با شیب صفر درصد با زمان 10، 12 و 15 دقیقه روی تردمیل راه رفتند. گروه کنترل نیز در طول اجرای پروتکل به همین ترتیب روی تردمیل راه رفتند(56، 3،48 )(جدول 2).

نمونه گیری

با خاتمه دوره تمرینی و 48 ساعت پس از آخرین جلسه تمرین گروه های تجربی تمرینی و پس از 12 ساعت ناشتایی موش‌ها توسط ماده بیهوشی اتر بیهوش و قربانی شدند. نمونه‌های خون از طریق خون گیری از قلب جمع آوری و در دمای 20- درجه سانتی گراد نگهداری شد. گلوکز با استفاده از دستگاه اتو آنالیزر و انسولین توسط کیت مخصوص شرکت پارس آزمون اندازه گیری شدند. شاخص مقاومت به انسولین(HOMA-IR) با استفاده از فرمول محاسبه گردید(58).

405/ (گلوکز (mg/dl ) * انسولین(µUI/ml ) = مقاومت به انسولین(HOMA-IR)

روش بیان ژن Bax و Bcl2 بافت قلب

بافت قلب به منظور اندازه گیری بیان ژن جدا و بلافاصله توسط ازت مایع به فریزر منفی 80 درجه سانتی‌گراد منتقل شد. ﻣﻘﺪاری از بافت قلب ﺑـﺮای اﻧﺠﺎم ﻣﺮاﺣﻞ رﻳﻞ ﺗﺎﻳﻢ درون RNA later ﻗﺮار داده و ﺳﭙﺲ در ﻓﺮﻳﺰر ﻣﻨﻔﻲ 20 درﺟﻪ ﺳﺎﻧﺘﻲ‌ﮔﺮاد ﻗﺮار داده ﺷﺪ. در ﻣﺮﺣﻠﻪ ﺑﻌﺪ RNA ﺑﺎ اﺳﺘﻔﺎده از ﻛﻴﺖ RiboEx Total RNAisolation solution (GeneAll) اﺳﺘﺨﺮاج و در ﻧﻬﺎﻳﺖ ﺑﺮرﺳﻲ ﻛﻤﻲ و ﻛﻴﻔـﻲ آن ﺑﺎ اﺳﺘﻔﺎده از دﺳﺘﮕﺎه ﻧﺎﻧﻮدارپ و ژل آﮔـﺎرز ﻳـﻚ درﺻـﺪ اﻧﺠﺎم ﺷﺪ. ﭘﺲ از اﻃﻤﻴﻨـﺎن از ﺧﻠـﻮص وکیفیت RNA  اﺳـﺘﺨﺮاج ﺷﺪه، cDNA ﺑﺎ اﺳﺘﻔﺎده از ﻛﻴﺖ FIRE Script RT cDNA Synthesis (Solis BioDyne) ﺳﺎﺧﺘﻪ و ﺑﻪ ﻓﺮﻳﺰر ﻣﻨﻔﻲ 20 درجه اﻧﺘﻘﺎل داده ﺷـﺪ. ﺳـﭙﺲ ﺑـﺮای ﺑﺮرﺳـﻲ بیان ژن Bax و Bcl2 بافت قلب، ﭘﺮاﻳﻤﺮﻫـﺎی ﻣـﻮرد اﺳـﺘﻔﺎده در اﻳـﻦ ﭘﮋوﻫﺶ ﺗﻮﺳﻂ ﻧﺮم اﻓﺰار Primer3 ﻃﺮاﺣﻲ و ﺗﻮﺳﻂ ﺷﺮﻛﺖ بیوتکنولوژی پیشگام ﺳﻨﺘﺰ ﮔﺮدﻳـﺪ. ﺗﻮاﻟﻲ ﭘﺮاﻳﻤﺮﻫـﺎی ﻣﻮرد اﺳﺘﻔﺎده در ﺟﺪول 3 آورده ﺷﺪه اﺳﺖ.

روش تجزیه و تحلیل داده ها

داده ها با استفاده از نرم افزار SPSS22 تجزیه و تحلیل شدند. برای توصیف داده‌ها از آمار توصیفی(میانگین و انحراف استاندارد) استفاده گردید. آزمون کولموگروف–اسمیرنف جهت تعیین طبیعی بودن توزیع داده‌ها و آزمون لوین برای تجانس واریانس‌ها و از آمار استنباطی تحلیل واریانس یک راهه و آزمون تعقیبی بن فرونی جهت مقایسه تفاوت بین گروه‌ها و از آزمون تحلیل واریانس دو عاملی و شاخص تعیین اندازه اثر جهت مقایسه میزان تاثیر هر یک از متغییرهای مستقل استفاده شد. آﻧﺎﻟﻴﺰ آﻣﺎری ژن Bax و Bcl2 ﺑﺎ اﺳﺘﻔﺎده از ﻧﺮم اﻓﺰار SPSS22 اﻧﺠﺎم ﺷﺪ. در این جا ﮔﺮوه ﺷـﺎﻫﺪ ﺑﻪ ﻋﻨﻮان رﻓﺮﻧﺲ ﺳﺎﻳﺮ ﮔﺮوهﻫﺎ ﻣﻲﺑﺎﺷـﺪ و ﺑﺮﺣﺴـﺐ اﻳـﻦ ﮔﺮوه P-Value ﺳﺎﻳﺮ ﮔﺮوهﻫﺎ ﺑﻪ دﺳﺖ آورده و سطح معنی داری 05/0 ≥p در نظر گرفته شد.

نتایج

میانگین وزن موش‌های مورد مطالعه در جدول 4 ارائه شده است. جدول 4 نیز میانگین وزن موش ها(گرم) قبل و پس از رژیم پر چرب را نشان می‌دهد. وزن بعد از اعمال رژیم پرچرب افزایش قابل مشاهده داشته است. اطلاعات توصیفی گلوکز و انسولین و شاخص مقاومت انسولین موش‌ها که پس از خون گیری از دم اندازه گیری شده نیز در جدول 4 مشاهده می‌شود که حاکی از دیابتی شدن موش‌ها می‌باشد. جدول 5، اطلاعات توصیفی وزن و گلوکز و انسولین و شاخص مقاومت به انسولین در گروه‌های مختلف را پس از هشت هفته تمرین تناوبی شدید و مصرف عسل آویشن نشان می‌دهد.

یافته های بیان ژن

نمودارهای منحنی ذوب بیان ژن و تصویر ژل الکتروفورز ژن های BAX و Bcl2 در ادامه آورده شده است. نمودار 3 بیان ژن Bax و Bcl2 و نسبت آن ها در گروه های مختلف را نشان می‌دهد.

تحلیل استنباطی یافته ها

یافته‌ها نشان داد میانگین وزن(گرم ) در گروه‌های تجربی نسبت به کنترل افزایش غیر معنی‌دار داشت. میانگین غلظت گلوکز(میلی گرم بر دسی لیتر) در گروه تمرین نسبت به کنترل کاهش معنی‌دار داشت و در گروه تمرین-عسل آویشن نسبت به گروه عسل آویشن کاهش معنی‌دار داشت و درگروه تمرین عسل نسبت به کنترل کاهش معنی دار داشت. انسولین در گروه تمرین تناوبی و گروه عسل آویشن و گروه تمرین تناوبی- عسل آویشن نسب به کنترل دیابتی افزایش معنی‌داری داشته است. هم چنین انسولین در گروه تمرین تناوبی-عسل آویشن نسب به تمرین تناوبی افزایش معنی داری داشته است. هم چنین انسولین در گروه عسل آویشن نسب به گروه تمرین تناوبی افزایش معنی داری داشته است. انجام تمرین تناوبی، شاخص مقاومت انسولین(HOMA-IR) را به طور معناداری کاهش داده است. ولی مصرف عسل آویشن شاخص مقاومت انسولین را افزایش معنادار داده است ولی انجام تمرین تناوبی و عسل آویشن شاخص مقاومت انسولی را افزایش غیر معنی دار داده است. آزمون تعقیبی نیز نشان داد شاخص مقاومت انسولین در گروه تمرین تناوبی نسبت به گروه عسل آویشن تنها و تمرین–عسل کاهش معنی‌داری داشته است. تمرین تناوبی برتغییرات بیان ژن Bax تاثیر معنی‌داری داشته و بیان این ژن در تمرین تناوبی نسبت به گروه عسل آویشن افزایش داشته و مصرف عسل آویشن نسبت به گروه کنترل کاهش غیر معنی دار وجود داشت و هم چنین بین تغییرات بیان ژن Bax بافت قلبی درگروه تعامل تمرین-عسل آویشن نسبت به سایر گروه‌ها تفاوت معناداری مشاهده نشد. تمرین تناوبی و عسل آویشن برتغییرات بیان ژن Bcl2 تاثیر معنی داری داشته و بیان این ژن در تمرین تناوبی و گروه عسل آویشن نسبت به کنترل افزایش معنی‌داری داشته و در گروه تعاملی تمرین تناوبی- مصرف عسل آویشن نسبت به کنترل افزایش غیر معنی‌دار وجود داشت. بین تغییرات بیان ژن Bcl2 بافت قلبی درگروه عسل آویشن نسبت به تمرین تناوبی تنها و تعامل تمرین-عسل آویشن افزایش معناداری مشاهده شد. هم چنین تمرین تناوبی و عسل آویشن بر نسبت BAX / BCL2 بافت قلبی در گروه‌های تمرین تناوبی و عسل آویشن کاهش داشته که در گروه عسل آویشن نسبت به تمرین و گروه تعاملی کاهش معنی داری داشته و درگروه تعاملی تمرین تناوبی-عسل آویشن نسبت به کنترل تفاوت معنی داری مشاهده نمی شود.

 

 

جدول 1-  ترکیب امولسیون پر چرب جهت گاواژ به موش های صحرایی

ماده

غذای رایج

غذای پرچرب 45%

غذای پرچرب 60%

کربوهیدرات (%)

03/50

41

26

پروتئین (%)

23

24

24

چربی (%)

1/5

24

35

چربی (Kcal%)

-

45

60

کالری (Kcal/g)

1/3

8/4

2/5

 

جدول2- پروتکل تمرین تناوبی

هفته

شدت گرم کردن

5 دقیقه

تعدادتناوب شدید

زمان­تناوب شدید

سرعت تناوب شدید

زمان­تناوب استراحت

شدت تناوب استراحت

شدت سرد کردن

5 دقیقه

 

زمان­کل( دقیقه )

اول و دوم

10متردردقیقه

2 تناوب

2 دقیقه

80 % سرعت بیشینه

( 30 متر در دقیقه )

1 دقیقه

50 %

( 16 متر در دقیقه )

10

متر در دقیقه

16

سوم و چهارم

10

4 تناوب

2 دقیقه

85%

(32 متر در دقیقه )

1 دقیقه

52 %

( 18 متر در دقیقه )

10

متر در دقیقه

22

پنجم و ششم

10

6 تناوب

2 دقیقه

90 %

(34 متر در دقیقه )

1 دقیقه

54 %

( 20 متر در دقیقه )

10

متر در دقیقه

28

هفتم و هشتم

10

8 تناوب

2 دقیقه

95%

(36 متر در دقیقه )

1 دقیقه

56 %

( 22 متر در دقیقه )

10

متر در دقیقه

34

 

ﺟﺪول 3- ﭘﺮاﻳﻤﺮﻫﺎی ﻣﻮرد اﺳﺘﻔﺎده در اﻳﻦ ﭘﮋوﻫﺶ

Oligo Name Genes

Primer Sequence (5′ → 3′)

Product size

Amplicon, bp

Gene Bank

Bax

For: AGGGTGGCTGGGAAGGC

Rev TGAGCGAGGCGGTGAGG

 

159 bp

17

17

 

NM_001191052.1

Bcl2

For:  ATCGCTCTGTGGATGACTGAGTAC

For:  AGAGACAGCCAGGAGAAATCAAAC

 

 

24

 

24

NM_001191052.1

GapDh

For: AAGTTCAACGGCACAGTCAAGG

Rev: CATACTCAGCACCAGCATCACC

164 bp

22

22

 

XM_008759265.1

 

 

جدول 4- اطلاعات توصیفی اولیه وزن و گلوکز و مقاومت به انسولین موش های صحرایی پس از رژیم پر چرب HFD و القای دیابت با STZ برای تشخیص دیابت نوع دوم

وزن شروع پروتکل (گرم)

وزن پس از چاقی

گلوکز( mg/dl )

انسولین (µUI/ml )

HOMA.IR

19.46 ±   197.7

51.69 ±  402.75

124.5 ±  363

0.49 ±  3.92

1.43 ±  3.56

 

 

 

 

 

جدول 5- نتایج آمار توصیفی مربوط به وزن نهایی و گلوکز و انسولین و شاخص مقاومت به انسولین

 

 

کد

وزن (گرم)

گلوکز(mg/dl)

انسولین(µUI/ml)

HOMA.IR

کنترل دیابتی

C

3/71 ± 317

1/102 ± 465

53/0 ± 9/3

33/0 ± 18/3

HIIT

E

28/54 ± 12/373

39/160 ± 245

35/1 ± 22/6

35/0 ± 04/2

عسل آویشن

H

43/23 ± 66/337

68/92 ± 83/305

91/0 ± 10/10

71/0 ± 81/3

HIIT  + عسل آویشن

HE

68/77 ± 5/334

5/24 ± 12/138

4/1 ± 43/11

5/0 ± 41/3

 

 

شکل 1-تصویر الکتروفورز بیان ژن BAX

 

نمودار 1- منحنی استاندارد بیان ژن BAX

 

 

 

شکل 2- تصویر الکتروفورز بیان ژن Bcl2

 

نمودار 2- منحنی استاندارد بیان ژن Bcl2

 

 

 

 

 

 

 

 

 

 

نمودار 3- بیان ژن Bax در گروه های مختل Bax Gen ( Fold change ratio)

جدول 6 - نتایج تحلیل واریانس دو عاملی و اندازه اثرگروهها

متغییر/شاخص آماری

گروه

F

سطح معنی داری

اندازه اثر

وزن(گرم)

تمرین

1.267

0.271

0.05

 

عسل

0.146

0.706

0.006

 

تمرین*عسل

1.589

0.220

0.062

 

گلوکز(میلی گرم بر دسی لیتر)

تمرین

22.18

0.0001

0.480

 

عسل

10.46

0.004

0.304

 

تمرین*عسل

0.410

0.528

0.017

 

انسولین (µUI/ml )

تمرین

06/17

001/0

416/0

 

عسل

7/165

001/0

873/0

 

تمرین*عسل

25/1

275/0

049/0

 

شاخص مقاومت به انسولین

تمرین

84/16

0001/0

412/0

 

عسل

48/28

0001/0

543/0

 

تمرین*عسل

84/3

062/0

138/0

 

بیان ژن Bax

تمرین

4.018

0.056

0.143

 

عسل

1.80

0.192

0.070

 

تمرین*عسل

0.059

0.811

0.002

 

بیان ژن Bcl2

تمرین

1.69

0.206

0.066

 

عسل

3.93

0.059

0.141

 

تمرین*عسل

12.71

0.002

0.346

 

نسبت Bax/Bcl2

تمرین

1.48

0236

0.058

 

عسل

0.840

0.369

0.034

 

تمرین*عسل

12.71

0.004

0.3

 

                 

 

 

بحث و نتیجه گیری

براساس یافته‌های تحقیق حاضر گلوکز در گروه های تجربی تمرین و تمرین- عسل آویشن نسبت به سایر گروه ها کاهش معنی دار داشته است که نتایج تحقیق حاضر با نتایج تکماکیدیس و همکاران(2004)(55) و یوسفی پور و همکاران(1393)(59) ، جرج و همکاران(2011)(30) هم سو بود. تکماکیدیس و همکاران بعد از3 و16 هفته تمرینات ورزشی، کاهش معنی‌دار گلوکز خون ناشتا و بهبود حساسیت به انسولین را در آزمودنی‌های دیابتی نوع 2 مشاهده کردند. هم چنین، این نتایج هم سو با نتایج جرج و همکاران بود. آن ها بعد از 12 هفته فعالیت ورزشی در سه گروه ورزشی، کاهش معنادار گلوکز خون را گزارش کردند(59، 55 ، 30). دلایل فیزیولوژیکی این نتایج هم سو با نتایج حاضر این است که تمرینات ورزشی، باعث افزایش برداشت گلوکز در عضلات بدن می شوند که این تغییرات وابسته به تغییرات عملکردی در سیگنال های انسولینی و مرتبط با افزایش محتویات پروتئین GLUT-4 می باشند و ورزش جدا از تقویت عملکرد انسولین، با افزایش گیرنده های GLUT-4 باعث افزایش برداشت گلوکز می شود(49). اما مغایر با نتایج حاضر، کاوزا و همکاران(2005)(10) بعد از 4 ماه تمرینات هوازی بر آزمودنی های دیابتی نوع دو و بیلو و همکاران(2011)(8) بعد از 8 هفته فعالیت ورزشی هوازی هیچ گونه کاهش معنی داری در گلوکز خون مشاهده نکردند. در مطالعه کاوزا و همکاران مدت تمرینات در هر جلسه(15 تا 30 دقیقه) نسبتاً کم بود. هم چنین در مطالعه بیلو و همکاران، هم مدت تمرینات(30دقیقه در هرجلسه) نسبتاً پایین بود و شاید علت عدم تغییر معنی دار در گلوکز خون ناشتا به همین سبب باشد؛ زیرا مدت و شدت کافی تمرینات ورزشی از عوامل موثر در کاهش گلوکز خون است(10، 8) . در تحقیق حاضر گروه تعاملی تمرین و تمرین–عسل آویشن کاهش معنی داری را درمقایسه با گروه کنترل و عسل آویشن داشته که دلیل آن را به اثرت تمرین و دوز بالای مصرف عسل به همراه تمرین می توان نسبت داد. یافته‌های پژوهش نشان داد انسولین در گروه تمرین تناوبی و گروه عسل آویشن و گروه تمرین تناوبی-عسل آویشن نسب به کنترل دیابتی افزایش معنی‌داری داشته است. هم چنین انسولین در گروه تمرین تناوبی-عسل آویشن نسب به تمرین تناوبی افزایش معنی‌داری داشته است. هم چنین یافته‌ها نشان داد انجام تمرین تناوبی، شاخص مقاومت انسولین(HOMA-IR) را به طور معنا داری نسبت به کنترل و گروه‌های دیگر کاهش داده است ولی با مصرف عسل آویشن شاخص مقاومت انسولین افزایش معنادار داشت و در گروه تعاملی تمرین تناوبی- عسل آویشن شاخص مقاومت انسولین هم نسبت به کنترل تغییر معنی دار نداشت. بنابراین کاهش مقاومت به انسولین در گروه تمرین دیابتی نسبت به گروه کنترل دیابتی می‌تواند نشان از سازگاری‌های سطح سلولی ناشی از تمرین باشد. به نظر می‌رسد تغییرات انسولین در گروه تمرین دیابتی نسبت به گروه کنترل دیابتی احتمالاً با بهبود عملکرد سلول‌های بتای پانکراس قابل توجیه باشد. فعالیت ورزشی، طبق مطالعات پیشین به عنوان یک عامل موجب افزایش حساسیت انسولین تحت شرایط نرمال و بهبود عملکرد انسولین در اشخاص و مدل‌های حیوانی مقاوم به انسولین می‌شود. هورمون انسولین با تحریک مصرف گلوکز در بافت‌های ماهیچه‌ای و چربی و منع گلوکونئوژنز در کبد به حفظ هموستاز گلوکز بدن کمک می‌کند. علاوه بر این انسولین با اثر بر مغز، سلول‌های بتای پانکراس، قلب و اندوتلیوم عروق خونی به هماهنگی و کنترل هموستاز متابولیک و سیستم قلبی- عروقی کمک می‌کند. اثرات انسولین به صورت وابسته به غلظت و اشباع پذیر می‌باشد(8). یافته های پژوهش حاضر نشان داد که در گروه تمرین تناوبی شدید بیان ژن آپوپتوزی Bax افزایش یافت ولی مصرف عسل آویشن بیان ژن عامل آپوپتوزی Bax را در بافت قلبی کاهش داد و منجر به افزایش بیان ژن عامل ضد آپوپتوزی Bcl2 بافت قلبی موش‌های نر دیابتی نوع دوم گردید. جعفـری و همکـاران(2015) در پژوهشی نتیجه گرفتند انجام 12 هفتـه تمرینـات استقامتی با شدت متوسـط تـا شـدید میـزان پـروتئین Bcl2 بــین گــروه تمرینــی و گــروه کنتــرل در قلــب موش‌های ویستار تفـاوت معنـاداری نداشـت(29). هم چنـین احمدی اصل و همکاران(2007) نشان دادند که 12 هفته تمرین هوازی با شدت متوسط تأثیری بر میزان آپوپتوز میوکارد موش‌های ویسـتار نـدارد، امـا 24 و 36 هفتـه تمرین استقامتی میـزان آپوپتـوز را بـه طـور معنـاداری کاهش می‌دهد(2). در نهایت مارش و همکاران(2001) نشان دادند که تمرینات هوازی بلند مدت(14 هفته) تـأثیری بر میزان Bax و Bcl2 و نسبت Bax/Bcl-2  موش‌های نر ویستار نداشت(42). اما در پژوهش حاضر بیان این ژن ها پس از هشت هفته تمرین تناوبی شدید توام با مصرف عسل آویشن تغییر معنی‌داری داشت. اگرچـه مکانیسـم دقیق آپوپتوز هنوز مشخص نیست؛ اما ممکـن اسـت بـا توجه به نوع سلول و نوع تحریکات متفاوت باشـد(12). نشان داده شده اسـت کـه تمـرین ورزشـی سـبب القـا آپوپتوز می‌شود که یک روند طبیعی برای از بین بـردن سلول های آسیب دیـده اسـت کـه در آن واکـنش هـای التهابی چشمگیری رخ نمی دهد. این روند باعث حصول اطمینــان از عملکــرد طبیعــی بــدن مــی‌شــود(44). مسیرهای پیام رسانی مختلفی سلول را به سـوی مـرگ برنامه ریزی شده یا آپوپتوز می‌برند که در ایـن فرآینـد پروتئین‌های ویژه‌ای بـه عنـوان فاکتورهـای آپوپتـوزی نقش دارند. این پروتئین‌ها عاملی هستند که در نهایـت ترکیبات کلیدی سلول هم چون پروتئین‌های ساختاری اسـکلت سـلولی و پـروتئین‌هـای هسـته‌ای را تخریـب می‌کنند(45). حساسیت سلول به آپوپتوز بـه تعـادل و نسبت فاکتورهای پیش آپوپتـوزی(Bid و Bax ) و ضـد آپوپتوزی(Bcl-xl و Bcl2 ) بستگی دارد و در حقیقت نسبت متوسط این پروتئین ها سرنوشت سلول را تعیـین می‌کند(14). سازوکارهای دقیق فعالیت ورزشی بـر تنظـیم مسـیر آپوپتوزی بافتی به درستی مشخص نیست، ولـی در تحقیقات قبلی مشاهده شده است که فعالیـت ورزشـی می‌تواند از طریق کـاهش پـروتئین پروآپوپتیـک Bax و افزایش پروتئین ضد آپوپتیک Bcl2 و در نتیجه مهـار آزادسازی سیتوکروم c مانع فعال شدن کاسپاز 9 شـود. کاسپاز 9 نیز با فعال سازی کاسپاز 3 می‌تواند منجر بـه تنظیم مثبت روند آپوپتوز شود(36). اگرچه در مقاله حاضر سطوح کاسپازهای 9 و 3 گزارش نشد ولی در تحقیقات دیگر مشاهده شد کـه فعالیـت ورزشـی بـا کاهش فعالیت کاسپاز آغـاز گـر 9 و کاسـپاز اجرایـی 3 می‌تواند از دو مسیر داخلـی و خـارجی مـانع آپوپتـوز و قطعه قطعه شدن DNA شود(36 ،11،32). اسـترس اکسایشـی به عنوان یک آغازگر مهم آپوپتوز در سلول هـا می باشـد. فرنچ و همکاران(2008) بیان کردند که حداقل در بخشی ممکن است بهبود عملکرد آنزیم هـای آنتـی اکسیدان از جمله فعالیت MnSOD در تعـدیل آپوپتـوز نقش داشته باشد این یک دیدگاه مهـم اسـت کـه اهمیت ورزش درمانی را برای بهبود سیگنال‌دهی آنتی‌اکسیدان به عنوان وسیله‌ای برای جلوگیری از آپوپتـوز برجسته می‌کند که لازم است این عوامل نیز همراه این فاکتورها اندازه گیری و بحث شود(20). به طور کلی با توجه به نتایج این پژوهش می توان نتیجه گرفت که انجام تمرینات تناوبی شدید توسط بیماران دیابتی شدید ضمن استفاده از مزایای متعدد آن می‌تواند منجر به افزایش عامل آپوپتوزی و کاهش عامل ضد آپوپتوزی بافت قلب شود، نسبت Bax/Bcl2 را افزایش دهد و بنابر این استفاده از شدت های تعدیل یافته تر و هم چنین استفاده از مواد غذایی با شاخص قندی و خواص آنتی‌اکسیدانی و ضد التهابی مناسب در کنار تمرین ورزشی برای مدیریت مصرف کربوهیدرات‌ها برای این افراد اجتناب ناپذیر است. یکی از قندهای مهم که میزان فروکتوز بالاتری نیز دارد و به جهت استفاده از خواص دارویی و ضدالتهابی و آنتی‌اکسیدانی بسیار مورد تاکید و توصیه است و در پژوهش‌های مختلف به ویژه روی افراد دیابتی چالش‌های جدی روی آن وجود دارد عسل طبیعی می‌باشد(39). قندهای موجود در عسل عمدتاً شکل فروکتوز، گلوکز و دیگر قندها مانند سوکروز و مالتوز(53) و مواد معدنی شامل کلسیم، پتاسیم، منگنز، سدیم، فسفر، گوگرد، روی و غیره(5) و ویتامین های A و B کمپلکس شامل B1، B2، B6،  B9، اسید پانتوتنیک، نیاسین، ویتامین C، D، E و K و سه آنزیم اصلی دیاستاز، ایتورناز و گلوکوزیداز به همراه آنزیم‌های دیگر مانند فسفاتاز، کاتالاز و پراکسیدازها در ترکیب عسل موجود می‌باشند. عسل هم چنین دارای مواد زیست فعال مانند ترکیبات فنولیک، فلانوئیدها، ارگوتنیک اسیدها و مشتقات کارتوئیدی می‌باشد. قابل توجه این که چندین ماده از مواد موجود در عسل دارای خاصیت آنتی‌اکسیدان هستند که از جمله می‌توان به آنزیم‌ها(کاتالازو، گلوکز اکسیداز)، اسیدها(اسکوربیک، فتوبیک، ارگانیک و آمینواسیدها) و دیگر ترکیبات(فلاونوئیدها ، مشتقات کارتنوئیدی) اشاره کرد. منشا گیاهی عسل بیشترین تاثیر را بر روی فعالیت آنتی‌اکسیدانی آن دارد. در مجموع برخی از ترکیبات عسل از شهد یا گرده گیاهان وارد عسل شده و بعضی از زنبور عسل طی فرآیند تولید عسل در آن تشکیل می شوند. مستندات و شواهد علمی زیادی نشان می دهند که عسل دارای چندین اثر مفید برای سلامتی است. از جمله این اثرات می‌توان به موارد زیر اشاره کرد: محافظت از دستگاه گوارش(23،40) محافظت از کبد(1) پایین آورنده قند خون و ضد دیابت و مهار کننده آنزیم‌های آلفا آمیلاز و آلفا گلوکوزید و پیشگیری از افزایش گلوکز خون بعد از غذا مخصوصاً در بیماران دیابتی، نقش آنتی اکسیدان و ضد التهابی(18،19،44). در پژوهش حاضر مصرف عسل آویشن از نظر عوامل آپوپتوزی و ضد آپوپتوزی مطالعه و مشاهده گردید که عامل آپوپتوزی Bax را کاهش و عامل آنتی آپوپتوزی Bcl2 را افزایش داد لذا برای چنین بیمارانی که به انجام چنین تمرینات شدیدی می پردازند به عنوان یک قند مناسب از این جهت می‌توان پیشنهاد داد. تمرین همراه با عسل آویشن می‌تواند باعث کاهش بیان ژن‌های عامل آپوپتوزی مانند Bax و افزایش بیان ژن‌های ضد آپوپتوزی مانند Bcl2 گردد و در بهبود سطوح گلوکز به واسطه تاثیر مولفه‌های ژنتیکی موثر در رهایی گلوکز کبدی و در بیماران دیابتی نوع دو موثر می باشد و عسل آویشن هم به دلیل ترکیبات متنوع ویتامینی و پروتئینی و ترکیبات فنلی و جایگزین خوب برای نقش گلوکز و نیز نقش‌های متعدد آنتی‌اکسیدانی و ضد التهابی و غیره موجب تنظیم متابولیسم کربوهیدرات ها به ویژه گلوکز و نیز تنظیم متابولیسم لیپید و کاهش هیپرگلیسمی و دیس لیپیدمی و کاهش مقاومت به انسولین می‌شوند و از استرس اکسیداتیو و پاسخ های التهابی افراد دیابتی نوع دو که دیابت مرتبط با ورزش و معمولاً همراه با اضافه وزن و چاقی نیز می‌باشد ممانعت می کنند(37). لذا استفاده از برنامه‌های تمرینی ورزشی هوازی از نوع تمرینات تناوبی می‌تواند اثر بخشی آن را بهبود بخشد با این وجود انجام مطالعات بیشتر و تکمیلی در این زمینه ضروری می باشد.

تشکر و قدر دانی

این مقاله مستخرج از رساله دکتری بود و با کد اخلاق IR.SSRC.REC.1399.080 در کمیته اخلاق پزشکی

 پژوهشگاه تربیت بدنی تایید شد لذا از تمام همکاران پژوهشی و پرسنل آزمایشگاهی تقدیر و تشکر می‌شود.

1.Abd-Elmoaty, M., Saleh, R., Sharma, R., Agarwal, A. (2010). Increased levels of oxidants and reduced antioxidants in semen of infertile men with varicocele. Fertil Steril, 94(4);1531-1534.
2.Agarwal, A., Sharma, RK., Desai, NR., Prabakaran, S., Tavares, A., Sabanegh, E. (2009). Role of oxidative stress in pathogenesis of varicocele and infertility. Urology, 73(3); 461-469.
3.Alizadeh, M., Nasebakht, A., Valizadeh, R. (2018). Apreliminary evaluation of serum level of testosterone, LH, and FSH in patients with varicocele after varicocelectomy as a kidney-related disease. Ther Clin Risk Manag, 4(14); 1585-1590.
4.Alsaikhan, B., Alrabeeah, K., Delouya, G., Zini, A. (2016). Epidemiology of varicocele. Asian J Androl, 18(2); 179–181.
5.Angeles-López, GE., González-Trujano, ME., Déciga-Campos, M., Ventura-Martínez, R. (2013). Neuroprotective evaluation of Tilia americana and Annona diversifolia in the neuronal damage induced by intestinal ischemia. Neurochem Res, 38(8); 1632-1640.
6.Azizollahi, G., Azizollahi, S., Babaei, H., Kianinejad, M., Baneshi, M., Nematollahimahani, S. (2013). Effects of supplement therapy on sperm parameters, protamine content and acrosomal integrity of varicocelectomized subjects. J Assist Reprod Genet, 30(4); 593-599.
7.Bong, GW., Koo, HP. (2004). The adolescent varicocele: to treat or not to treat. Urol Clin North Am, 31(3); 509-15.
8.Cárdenas-Rodríguez, N., González-Trujano, M., Aguirre-Hernández, E. (2014). Anticonvulsant and antioxidant effects of Tilia americana var. mexicana and flavonoids constituents in the pentylene tetra zole induced seizures. Oxid Med Cell Longev, 2014;329172.
9.Chen, SS., Chen, LK. (2011). Predictive factors of successful varico celectomy in infertile patients. Urol Int, 86(3); 320–324.
10-Chiba, K., Fujisawa, M. (2016). Clinical outcomes of varicocele repair in infertile men: a review. World J Mens Health, 34(2); 101–109.
11.Coballase-Urrutia, E., Cárdenas-Rodríguez, N., Carolina González-García, M. (2017). Biochemical and molecular modulation of CCl 4-induced peripheral and central damage by Tilia americana var. mexicana extracts. Saudi Pharm J, 25(3); 319-331.
12.Cüce, F., Demiray, Ö., Küçük, U., Olgun Küçük, H. (2016). Varicocele: tissue stress in the etiology. Turk JMed Sci, 46(4); 1014–1017.
13.Divya, V., Girish Kumar, V., Nandel, S., Ramchandra, SG. (2014). Dynamics of spermatogenesis. Annual Research & Review Biology, 4(1); 38-50.
14.Duke, JA. (2002). Handbook of Medicinal herbs. 2th ed. CRC Press, 467-8.
15.ElBardisi, H., Arafa, M., Rengan, AK. (2017). Varicocele among infertile men in Qatar. Andrologia, 49(4);
16.El-Sakka, AI., Hassoba, HM., Sayed, HM., Tayeb, KA. (2005). Pattern of endocrinal changes in patients with sexual dysfunction. J Sex Med, 2(4); 551-8.
17.Evarte-Bundere, G. (2014). Analysis of some limiting ecological factors on the example of the distribution of the genus Tilia L. cultivated in Latvia. Estonian Journal of Ecology, 63(3); 185-202.
18.Francavilla, S., Bruno, B., Martini, M. (1986). Quantitative evaluation of leydig cells in testicular biopsies of men with varicocele. Arch Androl, 16(2); 111-7.
19.Fujisawa, M., Dobashi, M., Yamasaki, T. (2001). Significance of seruminhibin B concentration for evaluating improvement in spermatogenesis after varicocelectomy. Hum Reprod, 16(9); 1945–1949.
20.Gat, Y., Gornish, M., Belenky, A., Bachar, GN. (2004). Elevation of serum testos terone and free testosterone after embolization of the internal spermatic vein for the treatment of varicocele in infertile men. Hum Reprod, 19(10); 2303–2306.
21.Goel, RK., Prabha, T., Kumar, MM., Dorababu, M., Singh, G. (2006). Teratogenicity of Asparagus racehorses Willd, Root. A herbal medicine Indian Jexp Bio, 44(7); 503-570.
22.Hatami, L., Estakhr, J. (2013). The effects of hydroalcoholic extract of Matricaria recutita on the hormonal pituitary-testis axis and testis tissue changes of mature male rats. Journal of Fasa University of Medical Sciences Spring, 3(1); 56-62.
23.Hayden, RP., Tanrikut, C. (2016). Testosterone and varicocele. Urol Clin North Am, 43(2); 223–232.
24.Hemmati Borujeni, N., Eidi, A., Mortazavi, P., Oryan, Sh. (2020). Effect of Tilia platyphyllos on cadmium chloride induced testicular damage in adult male wistar rats. Research in Medicine, 44(1); 270-275.
25.Jabeur, I., Martins, N., Barros, L., Calhelha, R., Vaz, J., Achour, L. (2017). Contribution of phenolic composition to the antioxidant, anti-inflammatory and antitumor potential of Equisetum giganteum L. and Tilia platyphyllos Scop. Food Funct, 8(3); 975-984.
26-Johnsen, SG. (1970). Testicular biopsy score count a method for registration of spermatogenesis in human testis: normal values and result in 352 hypogonadal males. Hormones, 1; 2-25.
27-Kaneko, T., Sasaki, S., Yanai, Y., Umemoto, Y., Kohri, K. (2007). Effect of microsurgical repair of the varicocele on testicular function in adolescence and adulthood. Int J Urol, 14(12); 1080–1083
28-Karioti, A., Chiarabini, L., Alachkar, A., Fawaz Chehna, M., Vincieri, F., Bilia, R. (2014). HPLC-DAD and HPLC-ESI-MS analyses of Tiliae flos and its preparations. J Pharm Biomed Anal, 100; 205-214.
29.Li, F., Yue, H., Yamaguchi, K. (2012). Effect of surgical repair on testosterone production in infertile men with varicocele: a meta-analysis. Int J Urol, 19(2); 149–154.
30.Liu, JJ., Dong, Q., Yang, YR. (2007). Effects of experimental varicocele on the testosterone level in the serum and testis of rats. Zhonghua Nan Ke Xue, 13(4); 335-7.
31.Luo, DY., Yang, G., Liu, JJ., Yang, YR., Dong, Q. (2011). Effects of varicocele on testosterone, apoptosis and expression of StAR mRNA in rat Leydig cells. Asian J Androl, 13(2); 287–291.
32.Merve, B., Sinem, I., Gozde, K. Reproductive toxicity after levetiracetam administration in male rats: Evidence for role of hormonal status and oxidative stress. PLoS One, 12(4); e0175990.
33.Morovvati, H., Moradi, H.R., Adibmoradi, M., Sheybani, MT., Salar Amoli, J. (2016). Effects of Wheat sprout extract on the quality of sperm in rats exposed to lead. Journal, Autumn, 12(3); 76-85.
34.Mostafa, T., Anis, T., Imam, H., El-Nashar, A., Osman, I. (2009). Seminal reactive oxygen species–antioxidant relationship in fertile males with and without varicocele. Andrologia, 41; 125-9.
35.Raboch, J., Mellan, J., Starka, L. (1975). Plasma testosterone in male patients with sexual dysfunction. Arch Sex Behav, 4(5); 541-5.
36.Redmon, JB., Carey, P., Pryor, JL. (2002). Varicocele- the most common cause of male factor infertility? Hum Reprod Update, 8(1); 53-58.
37.Rodríguez-Magaña, MP., Cordero-Pérez, P., Rivas-Morales, C. (2019). Hypoglycemic activity of Tilia americana, Borago officinalis, Chenopodium nuttalliae and Piper sanctum on wistar rats. J Diabetes Res, 1-6.
38.Salem, HK., Mostafa, T. (2009). Preserved testicular artery at varicocele repair. Andrologia, 41(4); 241–245.
39.Staub, C., Johnson, L. (2018). Review: Spermatogenesis in the bull. Animal, 12(1); 27-s35.
40.Tadayyon, F., Mellat, M., Khorrami, MF., Shahdoost, AA., Haghdoost, FS. (2011). Comparing the serum level of testosterone and the relative frequency of premature ejaculation in patients with varicocele and normal population. Journal of Isfahan Medical School Original Article, 28(124); 2032-2038.
41.Tiago, F., Elisabete, N-G., Sara, M. (2021). Toxicological and anti-tumor effects of a linden extract ( Tilia platyphyllos Scop.) in a HPV16-transgenic mouse model. Food Funct, 11,12(9); 4005-4014.
42.Tiseo, BC., Esteves, SC., Cocuzza, MS. (2016). Summary evidence on the effects of varicocele treatment to improve natural fertility in subfertile men. Asian J Androl, 18(2); 239–245.
43.Toker, G., Aslam, M., Zesilada, E., Memisolu, M., Ito, S. (2001). Comparative evaluation of the flavonoid content in officinal Tiliae flos and Turkish lime species for quality assessment. J Pharm Biomed Anal, 26; 111–21.
44.Turner, TT. (2001). The study of varicocele through the use of animal models. Hum Reprod Update, 7(1); 78-.84
45.Wein, A., Kavoussi, L., Partin, A., Peters, C. (2011). Campbell Walsh Text Book of Urology. 10th ed. Philadelphia: Elsevier, 810–820.
46.Yayalacı, Y., Celik, I., Batı, B. (2014). Hepatoprotective and antioxidant activity of linden (Tilia platyphyllos L.) infusion against ethanolinduced oxidative stress in rats. J Membr Biol, 247(2); 181-188.
47.Zargari, A. (1997). Medicinal plants, Tehran, Tehran University Publications., 7th edition; Vol. 1; 399-402.
48-Zeppa, S., Vallorani, L., Potenza, L. (2000). Estimation of fungal biomass and transcript levels in Tilia plathyphyllos tuber borchii ectomycorrhizae. FEMS Microbial Lett, 188(2); 119-124