فراوانی ژن های qnrA و sul1 در اشریشیاکلی جدا شده از ضایعات پری کاردیت و پری هپاتیت در جوجه های گوشتی استان اصفهان

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانش آموخته دانشکده دامپزشکی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران

2 بخش بهداشت و بیماری های طیور، دانشکده دامپزشکی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران

چکیده

ز
زمینه و هدف: مقاومت آنتی بیوتیکی علاوه بر پیچیده سازی درمان بیماری های عفونی دام و طیور، از نظر بهداشت عمومی نیز نگرانی بزرگی محسوب می شود. هدف از مطالعه اخیر تعیین فراوانی ژن های کد کننده مقاومت به کینولون ها و سولفانامیدها در اشریشیاکلی جدا شده از ضایعات پری کاردیت و پری هپاتیت در جوجه های گوشتی است تا پیش زمینه مناسبی برای درمان با این دسته از داروها در ضایعات ذکر شده فراهم شود.
روش کار: در این مطالعه به منظور ردیابی ژن های مقاومت علیه فلوروکینولون ها و سولفانامیدها، 50 سویه باکتری از مواد پریکاردیت و پری هپاتیت جوجه های گوشتی جداسازی شد و با تست های میکروبی و بیوشیمیایی، کلنی های اشریشیاکلی تایید شد. سپس با روش معمول آنتی بیوگرام، مقاومت سویه ها نسبت به آنتی بیوتیک های تجاری انروفلوکساسین و سولفانامید+تری متوپریم بررسی شد. علاوه بر آن، با روش جوشاندن، ژنوم باکتری استخراج شد و با پرایمر های اختصاصی به تکثیر ژن های qnrA و sul1 جهت ارزیابی مقاومت آنتی بیوتیکی علیه فلوروکینولون ها و سولفانامیدها پرداخته گردید.
یافته ها: در این بررسی، 54 درصد سویه های مقاوم علیه انروفلوکساسین واجد ژن qnrA و 48 درصد سویه های مقاوم علیه سولفانامیدها به علاوه تری متوپریم حاوی ژن sul1 بودند. در این بررسی سویه های مقاوم فاقد ژن های مورد بررسی نیز یافت شد که نشان از اهمیت سایر ژن های مقاومت در بروز مقاومت علیه سولفانامید ها و فلوروکینولون ها است.
نتیجه‌‌‌‌‌‌‌‌‌گیری‌‌‌‌‌‌‌‌‌: ارزیابی مقاومت آنتی بیوتیکی علیه انروفلوکساسین و سولفانامیدها به کمک یک ژن امکان پذیر نیست و برای تعیین دقیق مقاومت آنتی بیوتیکی تست های فنوتیپی معمول از کارایی بیشتری نسبت به ردیابی یک ژن خاص برخوردار است.

کلیدواژه‌ها


عنوان مقاله [English]

Frequency of qnrA and sul1 genes in Escherichia coli isolated from pericarditis and perihepatitis lesions of broilers in Isfahan province

نویسندگان [English]

  • Mohammad Horri 1
  • Majid Gholami-Ahangarn 2
1 Graduated of Veterinary Medicine Faculty, Shahrekord Branch, Islamic Azad University, Shahrekord, IRAN
2 Department of Poultry Diseases, Faculty of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
چکیده [English]

Inroduction & Objective: Antibiotic resistance can complicate the treatment of infectious diseases of livestock and poultry. The aim of this study was to determine the frequency of genes encoding resistance to quinolones and sulfonamides in Escherichia coli (E. coli) isolated from pericarditis and periphepatitis lesions in broilers to provide a suitable background for treatment with these drugs in these lesions.
 Material and Methods: In this study, for detecting of resistance genes to fluoroquinolones and suvanamides, 50 bacterial strains were isolated from broiler chickens with pericarditis and periphepatitis and E. coli colonies were confirmed by microbial and biochemical tests. Then, the resistance of the strains to the commercial antibiotics (Enrofloxacin and sulfonamide + trimethoprim) was evaluated by the conventional antibiogram method. In addition, the bacterial genome was extracted by boiling method and the qnrA and sul1 genes were amplified with specific primers to evaluate antibiotic resistance against fluoroquinolones and sulfonamides.
Results: In this study, 54% of enrofloxacin-resistant strains possed qnrA gene and 48% of sulfonamide-resistant strains plus trimethoprim contained sul1 gene. In this study, resistant strains without studied resistance genes were also found, which indicates the importance of other resistance genes in the development of resistance against sulfonamides and fluoroquinolones.
Conclusion: Evaluation of antibiotic resistance against enrofloxacin and sulfonamides is not possible with the help of one gene and to accurately determine antibiotic resistance, routine phenotypic tests are more effective than detecting a specific gene.

کلیدواژه‌ها [English]

  • Escherichia coli
  • Antibiotic resistance
  • Chiken

مقدمه

جنس اشریشیا، یکی از اعضای خانواده انتروباکتریاسه است که به عنوان جزئی از فلور طبیعی در روده بزرگ انسان و حیوانات وجود دارد. اشریشیا کلی یک باسیل گرم منفی که مانند سایر اعضای خانواده انتروباکتریاسه بی هوازی اختیاری است و به راحتی روی محیط های ساده رشد می کند(18). فعالیت همولیتیک در محیط آگار خون دار از ویژگی های برخی از سویه های اشریشیا کلی  است و در سطح محیط کشت آگار خون دار رشد کرده و کلونی های کروی و کوچک به اندازه 1 تا 2 میلی متر با سطح صاف، قوام آبدار و به رنگ خاکستری را تشکیل می دهد(30). دستگاه گوارش پستانداران در مدت کوتاهی پس از تولد اشریشیا کلی  را اخذ می کند. این باکتری به عنوان عضو مهم فلور طبیعی روده محسوب می شود. بسیاری از سوی های اشریشیا کلی  حدت پایینی دارند اما می توانند به صورت فرصت طلب در خارج از دستگاه گوارش سبب بیماری هایی مانند بیماری های دستگاه ادراری و غدد پستانی گردند و به عنوان یک باکتری فرصت طلب سبب عفونت های زخم، پنومونی، مننژیت و سپتی سمی در انسان شوند(2). از نظر اپیدمولوژی و بیماری زایی اشریشیا کلی عامل بیماری های مهمی در انسان و دام است که از جمله می توان به بیماری های روده ای(کلی باسیلوز روده ای، اسهال نوزادان و سپتی سمی نوزادان اشاره کرد(5). فاکتورهای زیادی در سویه های بیماری زای اشریشیا کلی  به آن ها اجازه می دهد که در سطوح مخاطی مستقر شده و متعاقباً ایجاد بیماری کنند. عوامل مستعد کننده ای که باعث استقرار باکتری و حساسیت حیوانات جهت بروز بیماری های بالینی می شود شامل سن، وضعیت ایمنی، ماهیت جیرة غذایی و نیز مواجهه با بار میکروبی زیاد است. از عوامل حدت سویه های پاتوژن اشریشیا کلی ، کپسول، فیمبریه، آندوتوکسین، ساختارهای مسئول کلونیزه شدن باکتری، آنتروتوکسین، وروتوکسین و سایر مواد ترشحی می باشد(7). انسان، بز، خوک، بوقلمون، ماکیان و غاز نیز مخازن باکتری هستند. حضور این باکتری در محیط عموماً به سطح شهرنشینی، عوامل انسانی و حیوانی، آب و هوایی و نیز میزان بارش بستگی دارد. در بررسی میکروبی، حضور اشریشیا کلی شاخص قابل اطمینان از آلودگی مدفوعی آب است و خطر ابتلا به بیماری های منتقله از طریق آب را نشان می دهد(22). کلی باسیلوز یکی از مهم ترین بیماری های پرورش ماکیان است که توسط سویه های گوناگون اشریشیاکلی ایجاد می شود. کلی باسیلوز در اغلب گونه های پرندگان اهلی و در سنین مختلف بروز می کند اما عفونت در پرندگان جوان شایع تر از بالغین است و بیشتر در سنین 4 تا 9 هفتگی رخ می دهد. از علایم بارز بالینی این بیماری ناراحتی تنفسی، تلفات کمتر از 5 درصد و شیوع بیش از 50 درصد همراه با یافته کالبد گشایی به صورت پلی سروزیت است(27). کاهش ضریب تبدیل غذایی، کاهش کیفیت لاشه، افزایش موارد حذف کشتارگاهی، بالا رفتن هزینه های درمان به واسطه مقاومت اکتسابی باکتری در برابر آنتی بیوتیک های رایج از دیگر مشخصه های این بیماری است. داروهای ضد باکتریایی به طور گسترده برای کاهش خسارات ناشی از کلی باسیلوز در ماکیان استفاده می شوند(24). در کنار مصرف داروهای ضدمیکروبی، مقاومت پیش روندهای ایجاد شده است. مبنای ژنتیکی بروز مقاومت آنتی بیوتیکی مشخص می باشد و این توالی های مولکولی بیشتر بین یک گونه یا بین انواع مختلف باکتری ها با اجزای ژنتیکی مثل پلاسمید، اینتگرون ها و ترانسپوزون ها قابل انتقال است. نگرانی از مقاومت به آنتی بیوتیک ها به خصوص مقاومت چند دارویی و پتانسیل دریافت فاکتورهای مقاومت توسط باکتری های انسانی از باکتری های حیوانات، سبب تغییر در روش استفاده از داروی ضدمیکروبی برای درمان کلی باسیلوز در ماکیان شده است(10). برای ارزیابی مقاومت آنتی بیوتیکی تست های فنوتیپی براساس ایجاد یا عدم ایجاد هاله عدم رشد در اطراف دیسک های آنتی بیوگرام تجاری به شکل معمول استفاده می گردد(5). با این حال تست های مولکولی بر مبنای تکثیر قطعه ای از ژنوم دخیل در مقاومت آنتی بیوتیکی علیه دسته ای از آنتی بیوتیک ها مورد توجه قرار گرفته است. مطالعات زیادی در داخل و خارج از کشور در خصوص مقاومت آنتی بیوتیکی در سویه های باکتریایی جدا شده از ضایعات کلی باسیلوز، محتویات دستگاه گوارش، گوشت و تخم طیور صورت گرفته است که نشان از اهمیت موضوع از لحاظ دامپزشکی و پزشکی می باشد. در ایران، به طور عمده مقاومت آنتی بیوتیکی با روش های معمول دیسک دیفیوژن انجام شده است و گزارشاتی از اهواز(1)، تهران(21) و آذربایجان(29) در خصوص فراوانی مقاومت آنتی بیوتیکی علیه آنتی بیوتیک های معمول و پر مصرف وجود دارد که نشان دهنده گستردگی مقاومت آنتی بیوتیکی در سویه اشریشیاکلی می باشد. این مطالعات نشان داده است به دنبال استفاده طولانی مدت از آنتی بیوتیک های متنوع، درجات وسیعی از مقاومت آنتی بیوتیکی در این باکتری ایجاد می گردد که در نهایت منجر به عدم کارایی آنتی بیوتیک های رایج می شود(22). از آن جایی که در بسیاری از موارد ارتباط معنی داری بین مصرف آنتی بیوتیک و بروز مقاومت آنتی بیوتیکی یافت نشده است به نظر می رسد انتقال ژنوم دخیل در مقاومت دارویی، در بین عوامل بیماری زا می تواند در بروز این حالت نقش مهمی داشته باشد. بسیاری از مقاومت های دارویی از طریق اکتساب پلاسمیدهای حاوی ژن‌های مقاوم یا به عبارتی اپی زوم ها و یا ترانس پوزون ها بروز می کنند. پلاسمیدها اجزای خارج کروموزومی هستند که می‌توانند به طور مستقل تکثیر کنند. ترانسپوزون ها توالی کوتاهی از مولکولDNA موجود در پلاسمید هستند که از طریق ترانسپوزیشن به سایر پلاسمیدها و یا کروموزوم ها منتقل می‌شوند(17،25). فاکتورهای انتقال مقاومت می توانند مسئول مقاومت نسبت به یک یا چند آنتی بیوتیک باشند. به طور کلی برای انتقال افقی مواد ژنتیکی و پلاسمیدها از یک باکتری به باکتری دیگر و ایجاد مقاومت روش‌های مختلفی مانند القا یا جابه‌جایی، الحاق، تغییر شکل و تغییر محل وجود دارد که در نهایت می تواند باعث تولید یک آنزیم خاص، تغییر در نفوذ پذیری میکروارگانیسم نسبت به دارو، انتقال فعال دارو به خارج، تغییر در گیرنده های دارویی و تغییر مسیر متابولیکی در باکتری مقاوم و تغییر در آنزیم هدف شود(13، 9). لذا مصرف نا صحیح و کنترل نشده آنتی بیوتیک ها علاوه بر بروز مقاومت آنتی بیوتیکی در سویه های چالش شده امکان بروز مقاومت آنتی بیوتیکی را در باکتری های دیگر نیز تسهیل می کند که این موضوع از نظر بهداشت عمومی اهمیت بسیار ویژه ای دارد. ژن sul1 فراوان ترین ژن دخیل در ایجاد مقاومت باکتری نسبت به سولفامیدها است که در باکتری های گرم منفی مانند اشریشیاکلی در انسان و حیوان وجود دارد. این ژن ازطریق ترانسپوزون و پلاسمید های بزرگ قابل انتقال است(16). مقاومت نسبت به فلوروکینولون ها نیز با ژن های مختلفی ایجاد می شود که qnrA  فراوان ترین ژن کد کننده مقاومت نسبت به کینولون بیان شده است. ژن های مقاوم نسبت به کینولون ها در جدایه های مختلف آنتروباکتریاسه در سراسر جهان یافت شده اند که بیشترین آن در اشریشیاکلی عنوان شده است(12). پروتئین خالص شده qnr به دو آنزیم DNA ژیراز و توپوایزومراز ۴ به منظور ممانعت از عمل آنتی بیوتیک های کوئینولون باند شده و از آن‌ها محافظت می کند و باعث ایجاد مقاومت می شود(25). هدف از انجام این پژوهش، بررسی میزان مقاومت آنتی بیوتیکی به شکل فنوتیپی و ژنوتیپی علیه دو آنتی بیوتیک پرکاربرد در صنعت پرورش طیور(انروفلوکساسین و سولفانامید) است تا نتایج به دست آمده از میزان مقاومت آنتی بیوتیکی علیه این دو دارو بر اساس تست فنوتیپی و ژنوتیپی مقایسه شود و امکان جایگزینی تست های ژنوتیپی بر اساس یک ژن خاص نسبت به تست های معمول فنوتیپی مورد ارزیابی قرار بگیرد.

مواد و روش ها

جمع آوری نمونه

در این پژوهش مقطعی طی مدت یک سال از فروردین 1399 تا فروردین 1400 از بین مجموع سویه های اشریشیاکلی جدا شده از موارد ابتلا به کلی باسیلوز طیور، 50 سویه انتخاب شد. سویه های انتخاب شده از سطح قلب(پری کاردیت) و کبد(پری هپاتیت) جداسازی شده اند(29).

شناسایی اشریشیاکلی

به منظور شناسایی باکتری اشریشیاکلی در نمونه مورد نظر با سواب یا انس استریل در کنار شعله با تلقیح بر روی نمونه مورد نظر بر روی محیط کشت مک کانگی به صورت خطی کشت داده  و به مدت 24 ساعت در انکوباتور 37 درجه سانتی گراد نگهداری می شود. در صورت رویت شدن پرگنه‌های لاکتوز مثبت(صورتی رنگ)، از پرکنه‌های مشکوک بر روی محیط EMB به صورت خطی کشت داده شده و به مدت 24 ساعت در دمای 24 درجه سانتی گراد انکوبه می‌شود. پرگنه‌های لاکتوز مثبت که بر روی محیط EMB ایجاد جلای سبز فلزی نموده اند به صورت اولیه به عنوان باکتری اشریشیاکلی شناسایی می‌گردند. سپس بر روی این پرگنه‌ها تست های افتراقی IMVIC انجام شد. در صورتی که از لحاظ تست های بیوشیمیایی تولید ایندول، احیای متیل رد،VP و احیای سیترات به صورت مثبت، مثبت، منفی، منفی باشند به عنوان اشریشیاکلی شناسایی می‌گردند(9).

تعیین مقاومت آنتی بیوتیکی  علیه انروفلوکساسین و سولفانامید

برای تعیین حساسیت باکتری جدا شده نسبت به آنتی بیوتیک انروفلوکساسین و سولفانامید+تری متوپریم از روش معمول انتشار دیسکی ساده به روش استاندارد کربی بوئر(Kirby-Bauer) استفاده شد. در این آزمون از محیط کشت مولر هینتون آگار و دیسک های آنتی بیوتیکی شرکت پادتن طب ایران انروفلوکساسین(5 میکروگرم بر دیسک)، سولفانامید + تری متوپریم استفاده شد.برای انجام آزمون حساسیت آنتی بیوتیکی هر جدایه باکتری بر روی محیط مک کانکی آگار به مدت 24 ساعت در دمای 37 درجه سانتی گراد کشت داده شد. سپس 4 تا 5 پرگنه از محیط مک کانکی آگار به لوله آزمایش حاوی TSB  منتقل و به مدت 3 ساعت در دمای 37 درجه سانتی گراد برای تهیه کدورت نیم مک فارلند انکوبه و پس از آن با سواب استریل از سوسپانسیون باکتریایی نیم مک فارلند روی محیط مولر هینتون آگار کشت خطی داده شد. پس از گذشت تقریباً 10 دقیقه، دیسک های آنتی بیوتیکی مورد نظر بر روی محیط مولر هینتون تلقیح شده، قرار داده شد و پلیت ها به مدت 18 ساعت در دمای 35 درجه سانتی گراد انکوبه گردید(22). سپس قطر هاله عدم رشد در اطراف هر دیسک اندازه گیری و در نهایت میزان مقاومت و حساسیت هر جدایه بر اساس دستورالعمل CLSI مشخص شد(29).

شناسایی ژن های مقاومت علیه آنتی بیوتیک ها

استخراج DNA

در این بررسی استخراج DNA از جدایه های مورد نظر به روش جوشانیدن و طبق دستورالعمل انجام شد. به این صورت که 500 میکرولیتر PBS را در داخل میکروتیوب یک و نیم میلی لیتری ریخته و سپس چند لوپ از کشت جامد (محیط لوریا برتانی 24 ساعته) به میکروتیوب اضافه و سوسپانسیون یکنواختی تهیه گردید. میکروتیوب های حاوی سوسپانسیون در سانتریفیوژ به مدت 5 دقیقه با سرعت 8000 دور در دقیقه قرار داده و بعد از این مرحله مایع رویی دور ریخته شد. مراحل یک و دو تکرار گردید و به میکروتیوب 500 میکرولیتر بافر TE اضافه و سوسپانسیون یکنواخت شد. میکروتیوب حاوی سوسپانسیون به مدت 10 دقیقه در بن ماری جوش قرار داده شد و بعد از عمل لیز باکتری به وسیله جوشانیدن، میکروتیوب در سانتریفیوژ به مدت 10 دقیقه با سرعت 13000 دور در دقیقه قرار داده و مقدار 30 میکرولیتر از میکروتیوب برداشته در یخچال منفی 20 درجه سانتی گراد برای مراحل بعدی آزمایش نگهداری گردید.

مراحل انجام PCR

به منظور شناسایی وضعیت مقاومت باکتریایی نسبت به آنتی بیوتیک های دسته فلوروکینولون ها و سولفانامیدها، ژن های مربوط به مقاومت نسبت به کوینولون ها(qnrA)، سولفانامیدها(sul1) در نمونه های مورد بررسی مورد تکثیر قرار گرفت. واکنش PCR در حجم نهایی 25 میکرولیتر شامل5/2 میکرولیتر PCR بافر X10، 5/1 میلی مول کلرید منیزیم، 2/0 میلی مول dNTP، 100 نانوگرم DNA الگو، 5/0 میکرومول از هر پرایمر، و یک واحد آنزیم Taq Polymerase در حجم نهایی 25 میکرولیتر آماده سازی شد. واکنش PCR در دستگاه ترموسیکلر اپندورف(آلمان) انجام شد. برنامه دمایی واکنش PCR به صورت واسرشت سازی اولیه در دمای 95 درجه برای 3 دقیقه، و 35 سیکل شامل واسرشت سازی در دمای 94 درجه برای 60 ثانیه، همسرشت سازی در دمای 47 و 50 (جدول 1) برای90 ثانیه و گسترش در دمای 72 درجه برای 60 ثانیه به همراه گسترش نهایی در 72 درجه سانتی گراد برای 10 دقیقه انجام شد. در نهایت، محصول PCR رنگ آمیزی شده با اتیدیوم بروماید بر روی ژل آگارز 5/1% الکتروفورز و با UV doc مشاهده و ثبت گردید.

نتایج

شناسایی اشریشیاکلی

سویه های مورد بررسی از جهت خصوصیات کشت بر روی محیط مک کانکی و EMB مورد بررسی قرار گرفتند و پس از تایید، تست های بیوسیمیایی IMViC در مورد آن ها انجام شد. تمامی 50 سویه مورد بررسی با ایجاد رنگ ارغوانی بر روی محیط کشت مک کانکی و ایجاد جلای سبز فلزی بر روی EMB تایید اولیه شدند و تست IMViC را به صورت ایندول مثبت، MR مثبت، VP منفی و سیترات منفی نشان دادند.

مقاومت آنتی بیوتیکی

پس از تایید باکتری و انجام آنتی بیوگرام، 35 و 25 سویه اشریشیاکلی به ترتیب علیه انروفلوکساسین و و سولفانامید به همراه تری متوپریم مقاومت نشان دادند به عبارتی 70 و 50 درصد سویه های مورد مطالعه علیه انروفلوکساسین و سولفانامید مقاوم بودند. در این بررسی 10 سویه اشریشیاکلی (20 درصد) و 5 سویه اشریشیاکلی(10 درصد) به شکل نیمه حساس نسبت به انروفلوکساسین و سولفانامید به علاوه تری متوپریم مقاومت نشان دادند. نتایج آنتی بیوگرام در جدول 2 آمده است.

ردیابی ژن های مقاومت آنتی بیوتیکی

الکتروفورز محصول PCR نشان داد 15 و 21 سویه از 50 سویه مورد بررسی توانستند قطعات 822(شکل 1) و 670(شکل 2) جفت بازی را تکثیر کنند و به ترتیب، حامل ژن های sul1 و qnrA باشند. به عبارتی در مطالعه اخیر از ۵۰ سویه اشریشیاکلی مورد بررسی 21 جدایه(42 درصد) دارای ژن مقاومت به کوینولون و 15 جدایه(30 درصد) دارای ژن مقاومت به سولفانامیدها بودند. در این بررسی 48 درصد سویه های مقاوم به سولفانامید بعلاوه تری متوپریم(12 سویه) حامل ژن sul1 و 2/54 درصد سویه های مقاوم به انروفلوکساسین(19 سویه) حامل qnrA بودند. 3 سویه از 50 سویه اشریشیاکلی(6 درصد) حاوی ژن sul1 فنوتیپ مقاومت علیه سولفانامیدها را از خود بروز ندادند. هم چنین 2 سویه از 50 سویه اشریشیاکلی(4 درصد) از سویه های حاوی ژن qnrA فنوتیپ مقاومت علیه انروفلوکساسین را نداشتند. علاوه بر این 52 درصد سویه های مقاوم به سولفانامیدها( 13 سویه) فاقد ژن sul1 بوده و 8/45 درصد از سویه های مقاوم به انروفلوکساسین( 16 سویه) ژن مقاومت qnrA را نداشتند. بیماران 6/3 برابر نسبت به حالت کنترل کاهش داد(P=0.021). سویه تجاری باسیلوس سوبتلیس میزان بیان ژن luxS در سویه اشریشیاکلی جداشده از بیماران را 1/1 برابر نسبت به گروه کنترل کاهش داد(P=0.025) و سویه بومی آن بیان این ژن را در سویه‌های اشریشیاکلی جداشده از بیماران 37/1 برابر نسبت به حالت کنترل کاهش یافت(P=0.028).

 

 

 

 

 

جدول 1- اختصاصات پرایمرهای مورد استفاده در شناسایی ژن های مقاومت آنتی بیوتیکی در اشریشیاکلی

آنتی بیوتیک

ژن مقاومت

توالی

اندازه محصول

دمای هم سرشت سازی

منبع

کینولون ها

qnrA

F:GGGTATGGATATTATTGATAAAG

R:CTAATCCGGCAGCACTATTTA

670

50

14

سولفانامیدها

Sul1

F:TTCGGCATTCTGAATCTCAC

R:ATGATCTAACCCTCGGTCTC

822

47

19

 

جدول 2- درصد مقاومت آنتی بیوتیکی در سویه های اشریشیاکلی جدا شده از موارد کلی باسیلوز

آنتی بیوتیک

مقاوم

نیمه حساس

حساس

درصد

فراوانی

درصد

فراوانی

درصد

فراوانی

انروفلوکساسین

70

35

20

10

10

5

سولفانامید+ تری متوپریم

50

25

10

5

40

20

 

جدول3- فراوانی ژن های مقاومت در سویه های اشریشیاکلی جدا شده از موارد کلی باسیلوز

ژن هدف

sul1

qnrA

درصد ردیابی در سویه های مقاوم به سولفانامید+ تری متوپریم (n=25)

48 درصد (12 سویه)

-

درصد ردیابی در سویه های مقاوم به انروفلوکساسین (n=35)

-

2/54 درصد (19 سویه)

 
   

 

 

شکل 1- الکتروفورز محصول PCR مربوط به تکثیر ژن sul1

 (ستون 1 تا 6: نمونه های مثبت 822 جفت بازی، ستون 7: مارکر، ستون 8: کنترل منفی).

 

 

شکل 2- الکتروفورز محصول PCR مربوط به تکثیر ژن  qnrA

(M: مارکر، ستون 1 تا 3: نمونه های مثبت 670 جفت بازی، ستون 4: کنترل منفی)

 

بحث و نتیجه گیری

نتایج به دست آمده از آنتی بیوگرام سویه های اشریشیاکلی جدا شده از موارد کلی باسیلوز طیور در مطالعه اخیر نشان می دهد که درصد بالایی از جدایه ها به آنتی بیوتیک های انروفلوکساسین و سولفانامید به علاوه تری متوپریم که جزء آنتی بیوتیک های معمول و رایج در صنعت طیور هستند مقاومت نشان می دهند. مقاومت ۷۰ درصدی در برابر انروفلوکساسین و نیز مقاومت ۵۰ درصدی در برابر سولفانامید به علاوه تری متوپریم نشان دهنده مقاومت بالای جدایه های اشریشیاکلی نسبت به آنتی بیوتیک های پرمصرف در صنعت پرورش طیور در منطقه اصفهان است. اگرچه الگوی مقاومت آنتی بیوتیکی در مناطق مختلف جغرافیایی و در مقاطع مختلف زمانی ممکن است متفاوت باشد(6) اما سایر مطالعات در ایران مربوط به استان های فارس، تهران، خوزستان و آذربایجان شرقی نشان می دهد که این الگو تا حدود زیادی مشابه است و نشان از توسعه مقاومت آنتی بیوتیکی در سویه های اشریشیاکلی دارد. در همین رابطه، جعفری و همکاران(۱۳۹۴) بیشترین مقاومت آنتی بیوتیکی را در جدایه های اشریشیاکلی طیور در اهواز با ۹۰ درصد مقاومت نسبت به انروفلوکساسین مشاهده کردند(1). رفیعی طباطبایی و نصیریان( ۲۰۰۳) در تهران بیشترین مقاومت را مربوط به تتراسایکلین(۹۴ درصد) و سپس سولتریم(۵۶ درصد) و انروفلوکساسین با ۴۴% گزارش کردند(21). زهرایی صالحی و فراشی بناب( ۲۰۰۶) در تبریز نیز بیشترین مقاومت را نسبت به داکسی سایکلین گزارش کردند(۸۸ درصد) اما مقاومت در برابر انروفلوکساسین نیز با ۷۶ درصد در رده سوم قرار داشت(29). مصرف گسترده انروفلوکساسین به تنهایی و مصرف هم زمان با برخی از خانواده‌های آنتی‌بیوتیکی می‌تواند دلیل این مقاومت بالا باشد که در فارم های پرورش طیور در سراسر ایران مورد استفاده قرار می گیرد. علاوه بر آن، مطالعات خارج از کشور نیز نشان می‌دهد که این آنتی بیوتیک در سایر کشورها نیز از مقاومت بالایی برخوردار است و بیشترین درصد مقاومت را به خود اختصاص داده است. در بررسی Gregova و همکاران(۲۰۱۲) در اسلواکی(11) و یانگ و همکاران(2004) در چین(28) نیز بیشترین مقاومت در جدایه های اشریشیاکلی طیور نسبت به انروفلوکساسین گزارش شده است. وجود مقاومت بالای آنتی بیوتیکی نسبت به انروفلوکساسین، سولفونامید به همراه متوپریم، فلورفنیکل و داکسی سایکلین می‌تواند به دلیل استفاده متداول از این آنتی بیوتیک ها در کنترل بیماری کلی باسیلوز باشد که تجویز پی در پی این آنتی بیوتیک ها، بعضاً بدون انجام تست‌های حساسیت آنتی بیوتیکی باعث ظهور و گسترش میکروارگانیسم های مقاوم به این آنتی بیوتیک ها شده است. از آن جایی که که ژن های مقاومت آنتی بیوتیکی در گسترش مقاومت در بین میکروارگانیسم‌ها نقش عمده‌ای دارند و اخیراً برای شناسایی سویه های مقاوم بیشتر مورد توجه قرار گرفته است، در مطالعه اخیر به پایش ژن های مقاومت نسبت به آنتی بیوتیک های فلوروکینولون و سولفونامید که از نظر دامپزشکی و پزشکی واجد اهمیت هستند پرداخته شد. در مطالعه اخیر از ۵۰ سویه اشریشیاکلی مورد بررسی 21 جدایه(42 درصد) دارای ژن مقاومت به کوینولون و 15 جدایه(30 درصد) دارای ژن مقاومت به سولفانامیدها بودند. در همین راستا، Ponce-Rivas  و همکاران(۲۰۱۲) نشان دادند که حدود ۵۲ درصد از جدایه های اشریشیا کلی  واجد ژن qnrA  بوده و در مجموع حدود ۷3 درصد از جدایه ها یکی از ژن های مقاومت کوینولون را دارا بودند که در بسیاری از جدایه ها ژن های qnr همراه با کلاس یک اینتگرون ردیابی نمودند(20). در خانواده انتروباکتریاسه مقاومت در برابر سولفانامیدها توسط 3 ژن کنترل می شود. ژن sul1 قسمتی از اینتگرون کلاس یک هست که فراوان ترین اینتگرون جدا شده از آنتروباکتریاسه ها هست به همین علت sul1 بارزترین نقش را در ایجاد مقاومت نسبت به سولفانامیدها دارد(3). در راستای مطالعات قبلی در خصوص بررسی ژن های مقاومت در برابر سولفانامیدها، مجاور رستمی و همکاران(۱۳۹۶) میزان مقاومت به سولفادیازین را در سویه های اشریشیاکلی جدا شده از موارد کلی باسیلوز جوجه های گوشتی در ارومیه حدود ۴۵ درصد گزارش کردند و بیان کردند که حدود 57 درصد از جدایه های اشریشیاکلی دارای ژن sul1 و ۵ جدایه که حامل ژن sul1 بودند نسبت به سولفانامید مقاومت نشان ندادند(16). نتایج مطالعه اخیر با مطالعه مجاور رستمی و همکاران در این خصوص هم خوانی دارد و به نظر می‌رسد اگر چه sul1  در ایجاد مقاومت نسبت به سولفانامیدها نقش دارد اما وجود ژن به تنهایی برای بروز مقاومت نسبت به سولفانامیدها کافی نیست و عوامل مختلفی در بیان این ژن و بروز فنوتیپ مقاومت نقش دارند. در مطالعه اخیر نیز میزان مقاومت نسبت به سولفانامیدها در تست آنتی بیوگرام ۵۰ درصد بوده است که از مجموع ۵۰ سویه اشریشیاکلی جدا شده 15 سویه یا به عبارتی ۳۰ درصد واجد ژن sul1 بودند. در این مطالعه ۴۸ درصد سویه های با فنوتیپ مقاومت علیه سولفونامیدها(12 سویه) واجد ژن sul1 بودند. وجود sul1 در سه سویه اشریشیاکلی حساس در برابر سولفونامید نشان می‌دهد که تنها وجود ژن برای بروز مقاومت کافی نیست بلکه لازم است شرایط لازم برای بیان آن هم فراهم شود. از طرفی وجود ژن sul1 در ۴۸ درصد سویه‌های مقاوم علیه سولفونامیدها نشان می‌دهد که تنها وجود sul1 برای بروز مقاومت کافی نیست و ممکن سایر ژن ها مثل sul2 و sul3 نیز نقش داشته باشند. به هر حال مطالعات گذشته نشان می‌دهد که در بین ژن های مقاومت به سولفانامیدها، sul1 از فراوانی بالاتری برخوردار هست و قبلاً نیز اهمیت ژن sul1 در ایجاد مقاومت علیه سولفونامیدها در اشریشیاکلی نشان داده شده است که نشان از اهمیت ویژه این ژن در بروز مقاومت علیه سولفانامیدها است(3). به طوری که در مازندران 4/69 درصد سویه ها، و در آذربایجان غربی نیز در 9/53 درصد از سویه های اشریشیاکلی مقاومت در برابر سولفانامیدها نشان داده شده است(6). هم چنین، در کشور پرتغال 23 درصد(4)، در تونس 41 درصد(23)، در تایلند 6/26 درصد(15) و در ویتنام 27 درصد(26) از سویه های اشریشیاکلی طیور واجد ژن sul1  بوده اند. قدمت استفاده از سولفامیدها در درمان بیماری های طیور و امکان مصرف هم زمان این آنتی بیوتیک با سایر آنتی بیوتیک های متداول در صنعت پرورش طیور می‌تواند دلیل گستردگی ژن های مقاومت مربوط به سولفانامیدها در بین سویه‌های اشریشیاکلی باشد. فراوانی بالا و حدود ۴۸ درصدی sul1  در سویه های مقاوم علیه سولفانامیدها و نیز ردیابی ۵۴ درصدی ژن qnrA در سویه های مقاوم به کینولون ها نشان می‌دهد که علاوه بر ژن های مورد بررسی، ژن های دیگری هم در مقاومت علیه سولفانامیدها و کوینولون ها نقش دارند و بروز مقاومت آنتی بیوتیکی مستلزم وجود ژن و بیان مناسب ژن است تا منجر به ظهور فنوتیپ مقاومت شود. لذا کماکان برای پایش وضعیت حساسیت آنتی بیوتیکی در موارد بیماری و یا در یک منطقه از نظر اپیدمی شناسی، بررسی وضعیت فنوتیپی مقاومت نسبت به ردیابی ژن های مقاومت قابل اعتماد تر است. به هر حال، درصد بالای ردیابی ژن های مقاومت در مطالعه اخیر دلالت بر گسترش و توسعه مقاومت در اشریشیاکلی دارد که وجود ژن های مقاومت و میزان مقاومت آنتی بیوتیکی در این میکروارگانیسم به عنوان شاخصی برای ارزیابی میزان مقاومت آنتی بیوتیکی در انسان و حیوانات به کار برده می شود به طوری که سویه‌های حامل ژن های مقاومت و بیماری زا می توانند به عنوان مخزن ژن های مقاومت در محصولات طیور و مصرف کننده نهایی یعنی انسان باشند.به طورکلی این مطالعه نشان داد که مقاومت آنتی بیوتیکی در سویه های جدا شده از موارد کلی باسیلوز طیور بسیار گسترده است و در واقع مقاومت‌های بالایی نسبت به داروهای متداول در صنعت پرورش طیور وجود دارد. مقاومت بالا دو نگرانی را به وجود می آورد اول این که مقاومت بالای آنتی بیوتیکی باعث عدم کارایی آنتی بیوتیک ها در کنترل بیماری های عفونی طیور می شود که منجر به تلفات و هزینه های بالای دارو درمانی می گردد و از طرفی دیگر، انتقال ژن های مقاومت به پاتوژن های انسانی، درمان بیماری های عفونی را در انسان پیچیده می کند و نگرانی‌های جدی برای بهداشت عمومی ایجاد می کند. لذا توصیه بر این است که حتماً در موارد بیماری های عفونی حساسیت آنتی بیوتیکی سنجیده شود و براساس حساسیت آنتی بیوتیکی داروی مناسب انتخاب شود. علاوه بر آن با رعایت دوز و دوره مصرف، الزاماتی موجود در خصوص تجویز آنتی بیوتیک ها رعایت شود و تا حد امکان از داروهایی که در پزشکی استفاده می شود استفاده نگردد

1-جعفری، ر.، قنبرپور ر.، قربان پور نجف آبادی، م.، میاحی، م. 1394. تعیین الگوهای مقاومت آنتی بیوتیکی در اشریشیا کلی  جداشده ازجوجه های گوشتی سالم ومبتلا به کلی سپتی سمی دراهواز. مجله میکروبیولوژی دامپزشکی، سال 11، شماره 2،  ص 109-116.
2.Ansari Cheharsughi, M. S., Ahmadi-Dastgerdi, A., Gholami-Ahangaran, M. (2020). Antibacterial effect of Capparis spinosa and Pistacia atlantica extracts on growth of Escherichia coli in vitro and in vivo. Iran Vet Clin Pathol, 14(54); 115-126.
3.Cattoir, V., Nordmann, P. (2009). Plasmid mediated quinolone resistance in gram negative bacterial species: an update. Curr Med Chem. 16(8); 1028-46.
 
4.Costa, D., Vinue, L., Poeta, P., Coelho, A.C., Matos, M., Saenz, Y. (2009). Prevalence of extended-spectrum beta-lactamase-producing
Escherichia coli isolates in faecal samples of broilers. Vet Mic, 138; 339-344.
5.Dehghani, G.S., Gholami-Ahangaran M., Rahimi, E. (2017). The comparison of Escherichia coli contamination rate in meat of conventional and without antibiotic chickens. Iran J Food Microbiol, 4(3); 93-100.
6.Ghaniei, A., Mojaverrostami, S., Lotfallahzadeh, B., Darzi Lemraski, M., Sepehrnia, P., Imani Jajarmi, A. (2014). Geographical and seasonal variation in antimicrobial susceptibility of Escherichia coli isolated from broiler chicken carcasses in Iran. Europ J Exp Biol, 4; 173-177.
7.Gholami-Ahangaran, M., Zia-Jahromi, N. (2014). Identification of shiga toxin and intimin genes in Escherichia coli detected from canary (Serinus canaria domestica). Toxicol Indust Health, 30(8); 724-727.
8.Gholami-Ahangaran, M., Ahmadi-Dastgerdi, A., Karimi-Dehkordi, M. (2020). Thymol and carvacrol; as antibiotic alternative in green healthy poultry production. Plant Biotechnol Persa, 2(1); 22-25.
9.Gholami-Ahangaran, M., Karimi-Dehkordi, M., Miranzadeh-Mahabadi, E., Ahmadi-Dastgerdi, A. (2021). The frequency of tetracycline resistance genes in Escherichia coli strains isolated from healthy and diarrheic pet birds. Iran J Vet Res, doi: 10.22099/ijvr.2021.38454.5592
10.Gholami-Ahangaran, M., Moravvej, A.H., Safizadeh, Z., Sadeghi Nogoorani, V., Zokaei, M., Ghasemian, S.O. (2021). The evaluation of ESBL genes and antibiotic resistance rate in Escherichia coli strains isolated from turkey meat and intestinal contents in Isfahan, Iran. Iran J Vet Res, DOI: 10.22099/IJVR.2021.39493.5737.
11.Gregova, G., Kmetova, M., Kmet, V., Venglovsky, J., Feher, A. (2012). Antibiotic resistance of Escherichia coli isolated from a poultry slaughterhouse. Annal of Agricul Environ Med, 19; 75-7.
12.Hooper, D.C., Jacoby, G.A. (2015). Mechanisms of drug resistance: quinolone resistance. Annal New York Acad Sci, 1354(1); 12-18.
13.Jacoby, GA.; Strahilevitz, J. and Hooper, DC. (2014). Plasmid-mediated quinolone resistance. Microbiol Spect, 2(2);100-110.
14.Kanaan, M. H. G., Al-Shadeedi, S. M., Al-Massody, A. J., Ghasemian, A. (2020). Drug resistance and virulence traits of Acinetobacter baumannii from Turkey and chicken raw meat. Comp Immunol Microbiol Infect Dis, 70; 101-111.
15.Mooljuntee, S., Chansiripornchai, P., Chansiripornchai, N. (2010). Prevalence of the cellular and molecular antimicrobial resistance against E. coli isolated from Thai broilers. Thai. J Vet Med, 40; 311-315.
16.Mojaver Rostami, S., Ghaniei, A., Mohammadi, V. (2018). Phenotypic and genotypic resistance of Escherichia coli isolated from broiler chickens of Urmia to sulfonamides. Iran Vet J, 13(4); 86-91.
17.Miles, T., McLaughlin, W., Brown, P. (2006). Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Vet Res, 2; 2-7.
18.Nolan, L.K., Vaillancourt, J., Barbieri, N.L., Logue, C.M. (2020). Coli bacillosis. In: Swayne, DE; Boulianne, M; Logue, CM; McDougald, LR; Nair, V and Suarez, DL (Eds.), Disease of Poultry. (14th Edn.), Massachusetts, W.B. Publishing. PP. 770-790.
19.Paniagua-Contreras, G. L., Hernández-Jaimes, T., Monroy-Pérez, E., Vaca-Paniagua, F., Díaz-Velásquez, C., Uribe-García, A., Vaca, S. (2017). Comprehensive expression analysis of pathogenicity genes in uropathogenic Escherichia coli strains. Microb pathogen, 103; 1-7.
20.Ponce-Rivas, E., Muñoz-Márquez, M. E., Khan, A. A. (2012). Identification and molecular characterization of class 1 integrons in multiresistant Escherichia coli isolates from poultry litter. Appl Environ Microbiol, 78(15); 5444-5447.
21.Rafiei Tabatabaei, R., Nasirian, A. (2003). Isolation, identification and antimicrobial resistance patterns of Escherichia coli isolated from chicken flocks. Iran J Pharmacol Therap, 2; 39-42.
22.Shahiri, M., Gholami-Ahangaran, M., Rahimi, E. (2018). The comparing of antibiotic resistance pattern in Escherichia coli isolates from chicken meat that reared under conventional and without antibiotic condition. Iran J Food Microbiol, 5(2); 11-18.
23.Soufi, L., Sáenz, Y., Vinué, L., Abbasi, MS., Ruiz, E., Zaragaza, M. (2011). Escherichia coli of poultry food origin as reservoir of sulphonamide resistance genes and integrons. Int J Food Microbiol, 144; 497-502.
24.Teimuri, S., Gholami-Ahangaran, M., Shakerian, A. (2018). The comparison of enrofloxacin residue in chicken and turkey meat, by high performance liquid chromatography in Isfahan province. Iran Food Hygiene, 8(4); 95-100.
25.Tran, J. H., Jacoby, G. A., Hooper, D. C. (2005). Interaction of the plasmid-encoded quinolone resistance protein Qnr with Escherichia coli DNA gyrase. Antimicrob Agents Chemother, 49(1); 118-125.
26.Van, T.T.H., Chin, J., Chapman, T., Tran, L.T., Coloe, P.J. (2008). Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes.  Int J Food Microbiol, 124; 217-223.
27.Wary, C., Davies, R. H. (2002). Colibacillosis. In: poultry Diseases, Edited by F. T. W. Jordan, M. Pattison, D. Alexander, and T. Foragher, 5th Ed. W. b. Saunders Company, U.S.A., pp: 125-130.
28.Yang, H., Chen, S., White, D.G., Zhao, S., McDermott, P., Walker, R. (2004). Characterization of multiple antimicrobial resistant Escherichia coli isolates from diseased chickens and swine in China. J Clin Microbiol, 42; 3483-9.
29.Zahraei Salehi, T., Farashi Bonab, S. (2006). Antibiotics susceptibility pattern of Escherichia coli strains isolated from chickens with colisepticemia in Tabriz province, Iran. Int J Poult Sci, 5; 677-684.
30.Ziauddini, A. H., Gholami-Ahangaran, M. (2020). Detection of virulence genes of intimin, hemolysin and shigatoxin in Escherichia coli isolated from Pscittacin. Iran New Cell Mol Biotechnol J, 10(38); 61-68.