تاثیر تمرینات استقامتی و مصرف عصاره گزنه بر بیان ژن BCL-2و TNF-αدر موش های مبتلا به سرطان ملانوما

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشجوی دکتری فیزیولوژی ورزشی،گروه فیزیولوژی ورزشی، واحد آیت الله آملی، دانشگاه آزاد اسلامی، آمل.ایران.

2 گروه فیزیولوژی ورزشی, واحد آیت الله آملی, دانشگاه آزاد اسلامی , آمل

3 دانشیار، گروه فیزیولوژی ورزشی، واحد آیت الله آملی، دانشگاه آزاد اسلامی، آمل.

4 استادیار،گروه فیزیولوژی ورزشی، واحد علوم و تحقیقات، دانشگاه آزاد اسلامی، تهران.ایران.

چکیده

زمینه و هدف: ملانوما وخیم ترین نوع سرطان پوست است که از سلول های رنگدانه ای ملانین تشکیل شده است. هدف از تحقیق حاضر بررسی تاثیر تمرینات استقامتی و مصرف گزنه بر بیان ژن BCL-2و  TNF-αدر موش های مبتلا به سرطان ملانوما بود.
روش کار: آزمودنی ها شامل موش های صحرایی نر ویستار بودند که پس از سازگاری دو هفته ای به صورت تصادفی به 4 گروه شامل گروه های: کنترل، تمرین، عصاره و تمرین+عصاره تقسیم شدند. برنامه تمرین شامل 30 دقیقه دویدن روی تردمیل بدون شیب و با سرعت 16 متر در دقیقه برای هفته اول بود و هر هفته یک متر بر دقیقه اضافه شد تا در هفته هشتم به 22 متر بر دقیقه رسید. یک هفته پس از القا سرطان ملانوما، گروه تجربی میزان 30 mg/kg/dayعصاره اتانولی گیاه گزنه را به روش خوراکی و به مدت 8 هفته مصرف کردند.برای اندازه گیری میزان بیان ژن از RT PCR استفاده شد.
یافته‌ها: تجزیه و تحلیل داده ها نشان داد که مصرف عصاره گزنه و تمرینات استقامتی بر سطح بیان ژنBCL-2 و TNF-αدر موش های مبتلا به سرطان ملانوما در گروه های مختلف کاهش معناداری دارد(به ترتیب p=0.000 ,p=0.025). هم چنین نتایج نشان داد که تفاوت سطح تغییرات بیان ژنBCL-2 و TNF-αبین گروه تمرین+عصاره با گروه کنترل(به ترتیب p=0.002 ,p=0.014)کاهش معناداری داشت.
نتیجه گیری: فعالیت بدنی منظم همراه با مصرف عصاره گزنه احتمالاً می تواند از طریق کاهش عوامل التهابی منجر به کاهش عوامل ضد آپوپتوزی و ایجاد آپوپتوز در سلول های سرطانی شود.

کلیدواژه‌ها


عنوان مقاله [English]

The effect of endurance training and consumption of nettle extract on the gene expression of BCL-2 and TNF-α in mice with melanoma

نویسندگان [English]

  • lila mosavi 1
  • barari barari 2
  • asieh Abbasi Daloii 3
  • hossien Abed Natanzi 4
1 PhD Student in Sport Physiology, Department of Sport Physiology, Ayatollah Amoli Branch, Islamic Azad University, Amol, Iran.
2 department of sport physiology,ayatollah amoli branch ,islamic azad university, amol
3 Associate Professor, Department of Sport Physiology, Ayatollah Amoli Branch, Islamic Azad University, Amol, Iran.
4 Assistant professor, Department of Sport Physiology, science and research Branch, Islamic Azad University, tehran, Iran
چکیده [English]

Inroduction & Objective: : Melanoma is the most serious type of skin cancer, which is made up of melanin pigment cells.The aim of this study was to evaluate the effect of endurance training and nettle consumption on BCL-2 and TNF-α gene expression in mice with melanoma.
Material and Methods: The subjects included male Wistar rats that after two weeks of adjustment were randomly divided into 4 groups including: control, exercise, extract and exercise + extract. Exercise program included 30 minute of running on a treadmill was steep and at a speed of 16 meters per minute for the first week, and every week one meter per minute was added until the eighth week it reached 22 meters per minute. One week after melanoma induction, the experimental group consumed 30 mg / kg / day of nettle ethanol extract orally for 8 weeks. RT PCR was used to measure gene expression.
Results: Data analysis showed that consumption of nettle extract and endurance training significantly reduced the expression level of BCL-2 and TNF-α genes in mice with melanoma in different groups (p = 0.000, p = 0.025, respectively). The results also showed that the difference in the level of changes in BCL-2 and TNF-α gene expression between the exercise and extract group with the control group (p = 0.002, p = 0.014, respectively) was significantly reduced.
Conclusion: Regular physical activity combined with consumption of nettle extract can probably reduce anti-apoptotic factors and cause apoptosis in cancer cells by reducing inflammatory factors.

کلیدواژه‌ها [English]

  • Apoptosis
  • Bcl-2
  • TNF-α
  • nettle extract
  • Melanoma Cancer

مقدمه

 

سرطان یکی از مهم ترین دلایل مرگ و میر در جهان است و دومین علت اصلی مرگ و میر پس از بیماری های قلبی عروقی است. سرطان با تغییر شکل سلول طبیعی ناشی از جهش های ژنتیکیDNA آغاز می شود. این سلول غیرطبیعی با تولید مثل غیرجنسی به صورت غیر طبیعی تولید مثل می کند، یعنی سیگنال های مربوط به تنظیم رشد سلول در اطراف خود را نادیده می گیرد و خصوصیات تهاجمی را به دست می آورد و باعث ایجاد تغییراتی در بافت های محاصره می شود(33، 1).سرطان یک مشکل مهم بهداشتی در کشورهای در حال توسعه و توسعه یافته است. هر ساله به طور متوسط 182 نفر در هر 100000 نفر در سراسر جهان از سرطان رنج می برند و 102 نفر بر اثر سرطان می میرند. طبق گزارش سازمان بهداشت جهانی، 14 میلیون نفر در سراسر جهان از سرطان رنج می برند و 8 میلیون نفر در اثر سرطان می میرند. میزان شیوع سرطان در ایران 7/134 در هر 100000 نفر است. بر اساس این آمار سالانه 85000 نفر در ایران از سرطان رنج می برند و 55000 نفر از سرطان می میرند. مرگ و میر ناشی از سرطان در سراسر جهان در حال افزایش است و پیش بینی می شود بیش از 13.1 میلیون مرگ در سراسر جهان تا سال 2030به علت سرطان رخ دهد(22 ،4 ،3 ،2 ). ملانوما تومور بدخیمی است که از ملانوسیت ها یا خال های تغییر شکل یافته ایجاد می شود(4). ملانومای بدخیـم 2 درصـد از کل سـرطان هـا را شامـل می گردد، ولی عامل 1 درصد مرگ و میرهای ناشی از سرطان است. در آمریکا هرسال تقریباً50000 مورد جدید از این بیماری گزارش می شود و شیوع آن نسبت به دیگر سرطان ها بسیار افزایش داشته است. شیوع این بیماری در مردان و زنان تقریباً یکسان است. از عوامل مستعدکننده این بیماری داشتن نژاد سفید، در معرض آفتاب شدید قرار گرفتن، سابقه خانوادگی، ژنتیک، سابقه ملانومای قبلی،سرکوب ایمنی و خال های غیرطبیعی است(10، 5). در غشاء پلاسمایی اغلب سلول ها گیرنده های مرگ وجود دارد. گیرنده های مرگ، اعضاء ابر خانوادة گیرندة فاکتور نکروز دهنده تومور(TNF:Tumor necrosis factor) می باشند. زمانی که این گیرنده ها توسط لیگاندهای مربوطه تحریک شوند، سبب فعال شدن کاسپازها و القاء آپوپتوز می شوند. در این بین، آپوپتوز اغلب از طریق دو مسیر کلاسیک داخل و خارج سلولی رخ می دهد. مسیر خارجی با اتصال لیگاندهای مهم مانند TNF و Fas به گیرنده های غشایی القاکننده ی مرگ راه اندازی می شود. در حالی که مسیر داخلی به عنوان مهم ترین مسیر ایجاد آپوپتوز، با تغییراتی در نفوذ پذیری غشای خارجی میتوکندری و رهایش عوامل آپوپتوزی همراه است(6). پژوهش ها نشان می دهند التهاب مزمن در کارسینوژنز انسان و پاتوژنز سرطان نقش موثری دارد. وضعیت التهابی را می توان با سطوح نشان گرهای آن در سرم مورد سنجش قرار داد. فاکتور نکروز تومور آلفا از مهم ترین سایتوکاین های پیش التهابی است که در رشد، تمایز، عملکرد سلولی و بقای بسیاری از سلول ها نقش دارد. TNF-α به وسیله ی انواع مختلفی از سلول ها شامل ماکروفاژها، نوتروفیل ها، فیبروبلاست ها، سلول های کشنده ی طبیعی، لنفوسیت های T و B و سلول های توموری تولید می شوند. چندین گزارش سطوح بالا و ناهنجار پروتئین TNF-α را در خون بیماران سرطانی در انواع سرطان مانند کلیه، پستان، ریه و پروستات گزارش کردند(19). این پژوهش ها نشان دادند که سطوح بالاتر TNF با درجه ی وخامت تومور همبستگی دارد و با عوارض سرطانی بیشتر و طول عمر کوتاه تر همراه است. بنابر این، این احتمال وجود دارد که TNF-α در پاتوژنز و پیشرفت سرطان نقش داشته باشد. پژوهش ها TNF-α را به عنوان پل ارتباطی بین التهاب و سرطان معرفی کرده اند(36). این سایتوکاین از طریق فعال نمودن مسیرهایNuclear Factor Kappa-Light-Chain- (NF-κB) ، Enhancer Of Activated B Cells و (AP-1) Activator Protein1 در پاتوژنز سرطان های انسانی و آزمایشگاهی نقش دارد(18). بنابر این پژوهشگران همواره به دنبال اتخاذ راهکارهای مناسب برای پیشگیری از آپوپتوز و بیماری های مختلف عضلانی مرتبط با آن هستند. در دهه ی اخیر، تأثیر فعالیت ها و تمرینات ورزشی بر آپوپتوز مورد علاقه ی محققان حوزه ی ورزش قرار گرفته است. در این زمینه، تعدادی از محققان عنوان کردند که یک جلسه فعالیت ورزشی شدید تا 48 ساعت می تواند موجب تسریع در فرآیند آپوپتوز شود(35). این در حالی است که بر خلاف فعالیت ورزشی، انجام تمرینات ورزشی با شدت متوسط و مداوم احتمالاً موجب کاهش آپوپتوز در بافت های مختلف می شود. در این راستا وینشتین وهمکاران اشاره داشتند که 10 هفته تمرین روی چرخ گردان موجب کاهش بیان پروتئین AIF و نسبت Bax/Bcl-2 درعضله ی نعلی موش های صحرایی نر تمرین کرده در مقایسه با موش های صحرایی تمرین نکرده شد(34). از طرف دیگر، جعفری و همکاران نشان دادند تمرین ورزشی سبب کاهش پروتئین پیش آپوپتوزی در عضله قلبی در موش های سالم می شود. تغییر در نسبت Bax/Bcl-2 برای القای آپوپتوز ضروری است و این نسبت معین می کند که سلول در معرض آپوپتوز قرار گیرد یا نه تغییر در نسبت Bax/Bcl-2 باعث رهایش سیتوکروم c از میتوکندری به درون سیتوزول می شود. سپس سیتوکروم c سیتوزولی به Apaf-1 متصل شده و منجر به فعال سازی کاسپاز 3 و PARP می شود که حاکی از نقش مهم کاسپازها در آپوپتوز است(11). مهارتقسیم Bcl-2 ممکن است به بیشتر فعال شدن کاسپازها پایین دست و در افزایش آبشار کاسپازهمکاری کند. افزایش جهش مقاوم در برابر تقسیم Bcl-2 برای حفاظت از بازگیری اینترلوکین- 3 و آپوپتوز مکرر ناشی از ویروس می باشد. بنابر این تقسیم Bcl-2 توسط کاسپازها از مرگ سلولی اجتناب ناپذیر ممکن است، مراقبت کند. Bcl-2 یک تنظیم کننده برنامه فعال سازی کاسپاز مستقل ازسیتوکروم c، Apaf-1، کاسپاز-8، آپوپتوزوم می باشد که به نظر می رسد برای تقویت سریع تر نسبت به آغاز آبشار کاسپاز است(21). طب سنتی سال ها است که به عنوان منبع ارزشمندی در صنعت داروسازی می باشد و ایران سابقه طـولانی در استفاده از ترکیبـات طبیعـی بـویژه گیاهـان دارد. 75-80 درصد جمعیت جهان و بـه ویژه کشـورهای در حال توسعه از داروهای گیاهی برای درمان بیماری ها استفاده می کنند، به این علت که معتقدنـد داروهـای گیاهی در کنار ارزان بـودن و قابـل دسـترس بـودن فاقــد عـــوارض جــانبی مـــی باشــند. یـــک داروی ضدسرطانی مناسب باید بتواند سلول هـای سـرطانی را بدون اثرات جانبی بر سلول های نرمال از بین ببرد. این شرایط ایده آل بـا القـاء آپوپتـوز بـر سـلول هـای سـرطانی بـه دسـت مـی آیـد. بسـیاری از داروهـای متداول از منابع گیاهی منشأ گرفته اند. در گذشته پایه بسـیاری از داروهـا از جملـه آسـپیرین، دیگوسـین و مورفین گیاهی بود(29). از گیاهان دارویی می توان به گیاه گزنه اشاره کرد. این گیاه قرن هاست که در طب عامیانه برای درمان طیف وسیعی از بیماری ها یا اختلالات مانند آرتروز، روماتیسم و اگزما مورد استفاده قرارمی گیرد(28). استفاده اخیر از عصاره های قطبی از ریشه گزنه، درمان هیپرپلازی خوش خیم پروستات است، در حالی که عصاره های محلول آن اثر ضد التهابی قوی نشان می دهد(27). گزنه دارای تانن، موسیلاژ، نوعی مـاده مـومی، اســید فورمیــک، یــک فیتوســترین، نیتــرات پتاســیم و اســید فورمیــک، یــک فیتوســترین، نیتــرات پتاســیم و کلســیم، ترکیبــات آهــن، نــوعی گلوکوزیــد بــا اثــر کلســیم، ترکیبــات آهــن، نــوعی گلوکوزیــد بــا اثــر قرمزکننده پوست است. گزنه معمولاً اثر مهاری بر آنزیم‌های لیپواکسیژناز و سیکلواکسیژناز دارد. این دو آنزیم مسئول تبدیل اسید آراشیدونیک به پروستاگلاندین‌ها و لکوترین‌ها است. گزنه به علت دارا بودن ترکیبات آنتی‌هیستامین و ضدالتهاب، داروی طبیعی برای بیماری اگزما است.از عصاره گزنه در محصولات آرایشی نیز استفاده می شود و کاربرد موضعی آنها فواید زیادی برای سلامت پوست دارد(به عنوان مثال ضد التهاب و ضد تورم). با این حال، یکی از جالب ترین اقدامات عصاره گزنه از خاصیت آنتی اکسیدانی و ضد التهابی آن ها حاصل می شود. گزنه تعدادی پاک کننده گونه های اکسیژن فعال را جمع می کند، که می تواند آسیب رادیکال های آزاد پوست را کاهش دهد و بنابراین اثرات ضد پیری دارد(16). توانایی القاء آپوپتوز در سلول های سرطانی و توقف تکثیر این سلول ها موضوع بسیاری از تحقیقات ایمونوفارماکولوژی می باشد. از جمله علل اصلی بروز سرطان ها می توان به تأثیر عوامل محیطی در ایجاد جهش و تغییرات ژنتیکی مسئول بروز بدخیمی ها اشاره کرد(23). فرآورده های طبیعی به ویژه گیاهان دارای پتانسیل بالایی برای ساخت ترکیبات دارویی می باشند. بسیاری از داروهای ضد سرطانی که سنتز شده اند، از جمله تاکسان ها، وینکا آلکالوئیدها، پودوفیلو توکسین ها و کامپتوتسین ها و غیره از ترکیبات گیاهی مشتق شده اند و برای درمان سرطان های مختلف متاستاتیک و غیر متاستاتیک مورد استفاده قرار کرفته است(26). پژوهش حاضر به دنبال پاسخ به این سوال است که هشت هفته تمرینات استقامتی همراه با مصرف عصاره گزنه چه تاثیری بر بیان ژن  BCL-2و TNF-αدر موش های مبتلا به سرطان ملانوما دارد؟

مواد و روش ها

کار تحقیقی مورد نظر در دانشگاه مرودشت شیراز و با کد اخلاق IR.IAU.M.REC.1399.008 تایید و ثبت گردید.32 سر موش صحرایی که از لحاظ ژنتیکی مشابه با یک دیگر هستند از مرکز پژوهش و تکثیر حیوانات آزمایشگاهی تهیه و به مرکز تحقیقات منتقل می شوند. حیوانات پس از ورود به محیط پژوهش و آشنایی دو هفته ای با محیط جدید و نحوه فعالیت روی نوارگردان، به صورت تصادفی به 4 گروه 1- کنترل سرطانی(بدون تمرین و عصاره)2-تمرین(سرطانی) 3- گزنه(سرطانی) 4- تمرین + گزنه(سرطانی) تقسیم می شوند. عصاره گزنه به مقدار 100 میلی گرم به ازای هر کیلوگرم وزن بدن به صورت درون صفاقی تزریق گردید(17 ،13، 4). حیوانات مورد آزمایش در این پژوهش در طی دوره آشنایی با محیط جدید و آشنایی با نوارگردان و هم چنین دوره اجرای پروتکل در قالب گروه های 5 سر موش در قفس های پلی کربنات شفاف با ابعاد 15 × 15 × 30 سانتی متر ساخت شرکت رازی راد و در دمای محیطی با 4/1±22 درجه سانتی گراد و چرخه روشنایی به تاریکی 12:12 ساعت و رطوبت هوا 4±55 درصد نگهداری شدند. در تمام مراحل پژوهش، آب مورد نیاز حیوان به صورت آزاد در اختیار آن ها قرار داده می شود. از آن جا که موش های آزمایشگاهی به بیماری های تنفسی بسیار حساس هستند، از این رو تهویه مناسب برای جلوگیری از تجمع آمونیاک حاصل از ادرار حیوانات در محل نگهداری قرار داده می شود. تمرین ورزشی چهار روز بعد از شروع مکمل دهی به مدت شش هفته، هفته ای 5 جلسه بر روی تردمیل انجام می شود. موش‌ها در گروه تمرین به منظور آشنا سازی با تردمیل یک هفته به مدت 10 تا 15 دقیقه با سرعت 10 متر بر دقیقه به مدت 5 روز ورزش می کنند. از هفته دوم مرحله اضافه بار به مدت سه هفته تا پایان هفته چهارم اعمال می شود. مرحله اضافه بار بدین گونه می باشد که در هر روز تمرینی 3 دقیقه به زمان فعالیت و یک متر بر دقیقه به بر سرعت تردمیل افزوده می شود، تا این که در پایان هفته چهارم سرعت تردمیل به 28 متر بر دقیقه و به مدت 60 دقیقه فعالیت برسد. از هفته چهارم تا ششم به مدت سه هفته مرحله تثبیت با سرعت 28 متر بر دقیقه و به مدت یک ساعت ادامه خواهد یافت(12، 8، 1). کــشت ســـلول هــای تومورملانومـــا: ســلول هـــایB16F10 از انیــستیتو پاســتور ایــران خریــداری شــدند. ایــن سلول ها به دلیل یکسان بودن نوع سلول با گونه ی موش مورد مطالعه انتخاب شدند. سلول ها در محیط کشت M199 کشت داده شده اند و و زمانی که تراکم سلولی به ۸۰ درصد رسید، برای تزریق به مـوش آمـاده شدند. تعداد سلول های زنده قبـل از تزریـق بـا رنـگ آمیـزی تریپان بلو شمارش گردید. به موش هـای مورد نظر در روز مطالعـه، از 32 سر موش، 16 موش در دو گروه گزنه و تمرین+گزنه به صورت زیر جلدی در پهلوی چپ تزریق شد(19). مقداری از ساقه و برگ گیاه گزنه را پس از برش به قطعات کوچک جمع آوری و شستشو داده، سپس در هوای آزاد خشک کرده و با دستگاه به صورت پودر در آمد. سپس 60 گرم پودر گیاه گزنه را داخل یک بشر 5/2 لیتری قرار داده و 2 لیتر آب مقطر را به ان اضافه کرده و بشر را روی هیتر مخصوص(مدل MR3001 K، شرکت Heidolphl آلمان) را حرارت ملایم قرار داده شد. پس از جوشاندن با کاغذ صافی جوشانده موردنظر تصفیه شد. عصاره گیری داخل دستگاه تقطیر در خلا دوار روتاری( Laboratory 4003 ساخت شرکت Heiodolf آلمان) با دمای 45 درجه سانتی گراد و فشار خلا mbar 65 و دور  rpm 20 قرار داده شد. برای تهیه محلول، عصاره آبی گیاه گزنه را در آب مقطر حل کرده و برای آن که کاملاً حل شود و محلولی رقیق و صاف به دست آید آن را داخل لوله فالکون و روی ورتکس قرار داده به نحوی که محلول به دست آمده به راحتی از سرنگ انسولین عبور کند، برای تهیه عصاره موردنظر مراحل بالا چندین بار تکرار شد. گروه های تجربی عصاره گزنه را به مدت 8 هفته و به مقدار 30 میلی گرم روزانه به ازای هر کیلوگرم وزن بدن دریافت کردند(14 ،13). 48 ساعت بعد از آخرین جلسه فعالیت استقامتی نمونه گیری انجام می شود. موش ها با تزریق درون صفاقی ترکیبی از کتامین(70mg/kg) و زایلوزین(5mg/kg) بیهوش و به منظور خون گیری از محفظه خارج و به روی میز جراحی انتقال داده می شوند(1). جهت خون گیری آزمودنی ها به پشت روی میز آزمایشگاه ثابت و با استفاده از سرنگ 5 سی سی بعد از برش شکم به صورت مستقیم از بطن راست حیوانات خون گیری انجام می شود. خون جمع آوری شده با سرعت  3000 دور در ثانیه سانتریفوژ و پس از جداسازی سرم و پلاسما، بافت های موردنظر برداشته شده و در تانک ازت 80- درجه سانتی گراد فریز گردید. سپس بافت ها برای نگهداری به آزمایشگاه انتقال داده می شوند و تا زمان اجرای پروتکل آزمایشگاهی مورد نظر نگهداری می شوند. برای بررسی بیان ژن ها از تکنیک Real time PCR توسط دستگاه Rotor Gene 6000 (Corbett Research, Australia) با تعداد 40 سیکل استفاده شد. پرایمرهای 3 ژن به همراه 1 ژن کنترل یا رفرانسGAPDH (glyceraldehyde 3-phosphate dehydrogenase) طراحی شد و برای سنتز به شرکت سیناکلون سفارش داده شد(جدول3-3). Delta Ct (ΔCT) با استفاده از فرمول زیر محاسبه شد. [ΔCT= CT (target) – CT] و سطح بیان ژن با روش– ΔCt2تعیین گردید. برای PCR از 2x master mix buffer، ترکیب پرایمر forward و reverse، cDNA و آب تزریقی استفاده شد. ترکیب حاصله به میزان 10 میکرولیتر در ویال مخصوص دستگاه کوربت تهیه و در روتر دستگاه قرار گرفت. میزان سطح mRNAs هر یک از ژن ها به طور نسبی در مقایسه با میزان سطح mRNAs ژن GAPDH محاسبه شد. توصیف کمی داده ها با استفاده ازشاخص های پراکندگی مرکزی از قبیل میانگین و انحراف استاندارد انجام و جهت تعیین نرمال بودن توزیع داده ها از آزمون شاپیرو ویلک و بررسی تجانس واریانس ها از آزمون لوین استفاده شد. هم چنین برای بررسی تغییرات معنی داری هریک ازمتغیرهای تحقیق،بین گروه های مختلف از روش آنالیز واریانس یک طرفه و در صورت مشاهده تفاوت معنی دار آماری از آزمون تعقیبی توکی در برنامه ANOVA جهت تعیین محل اختلاف بین گروهی استفاده گردید. سطح معنی داری برای تمام محاسبات 05/0>p در نظر گرفته شد. کلیه عملیات آماری با استفاده از نرم افزارSPSS نسخه 20 انجام شد.

نتایج

داده‌های حاصل از متغیرهای تحقیق برای 4 گروه در قالب جدول 1‌ به صورت توصیفی آورده شده است. نتایج نشان می دهد که کم ترین غلظت BCL-2 در گروه تمرین-عصاره و بیشترین سطوح آن در گروه کنترل مشاهده شد. هم چنین نتایج نشان داد که کم ترین غلظت TNF-αدر گروه تمرین-عصاره و بیشترین سطوح آن در گروه کنترل مشاهده شد. تجزیه و تحلیل داده ها با استفاده از آزمون آنالیز واریانس یک طرفه نشان داد بیان ژن BCL-2 و TNF-αدر گروه های تجربی نسبت به گروه کنترل روند کاهشی داشت(به ترتیب p=0.000 ,p=0.025). نتایج آزمون تعقیبی نشان داد که این تغییرات کاهشی بیان ژن BCL-2 فقط در گروه تمرین+عصاره نسبت به گروه کنترل معنادار است و در سایر گروه ها علیرغم کاهش به سطح معناداری نرسید. هم چنین سطح BCL-2 در گروه تمرین+عصاره در مقایسه با گروه عصاره کاهش معناداری داشت( p=0.002). هم چنین منحنی ذوب BCL2 و تصویر الکتروفورز در نمودار 1 و شکل 1 نشان داده شده است. نتایج آزمون تعقیبی نشان داد که سطح TNF-α در گروه های تمرین و تمرین+عصاره نسبت به گروه کنترل کاهش معناداری دارد(به ترتیب p=0.014 ,p=0.000). هم چنین سطح TNF-α در گروه تمرین+عصاره در مقایسه با گروه عصاره کاهش معناداری داشت(p=0.002). هم چنین منحنی ذوب و تصاویر الکتروفورز TNF-α در نمودار 2 و شکل 2نشان داده شده است.

 

 

جدول 1- مشخصات توالی پرایمرهای مربوط به هر یک از ژن ها

Gene

Forward

Reverse

BCL-2

ATCGCCCTGTGGATGACTGAGT

GCCAGGAGAAATCAAACAGAGGC

TNF-α

CTCTTCTGCCTGCTGCACTTTG

ATGGGCTACAGGCTTGTCACTC

جدول 2-میانگین و انحراف معیار مربوط به متغیرهای تحقیق

گروه

BCL-2

TNF-α

کنترل

62.0 ± 25.6

66/0 ± 31.9

تمرین

67.1 ± 07.4

71.1 ± 27.5

عصاره

78.2 ± 89.4

3.1 ± 69.7

تمرین+عصاره

97.1 ± 27.2

83.2 ± 3.3

نمودار 1-منحنی ذوب بیان ژن BCL2

شکل1- ژن الکتروفورز BCL2

نمودار2- منحنی ذوب بیان ژنTNF-α

شکل2- ژن الکتروفورز TNF-α

.

بحث ونتیجه گیری

 

نتایج تحقیق حاضر نشان داد که مصرف عصاره گزنه و تمرینات استقامتی بر سطح BCL-2 در موش های مبتلا به سرطان ملانوما در گروه های مختلف کاهش معناداری دارد. تفاوت سطح تغییرات بیان ژن BCL-2بین گروه کنترل با گروه تمرین+عصاره و هم چنین گروه عصاره با گروه ترکیبی معنادار است. اگر چه مکانیسم های دقیق آپوپتوز ناشی از ورزش به خوبی روشن نشده است، فرضیه های احتمالی زیادی وجود دارد که نیاز به تحقیقات بیشتر دارد. یکی از این فرضیه های احتمالی مهم در این خصوص این است که در حین فعالیت متابولیسم عضله افزایش می یابد که این مسئله به تولید گونه های فعال اکسیژن منتهی می شود. مقادیر بالای گونه های فعال اکسیژن می تواند آسیب اکسایشی تولید کرده و بنابر این به آپوپتوز از طریق مسیر داخلی منتهی شود(11). در مطالعه شریفی و همکاران نشان داده شده است که داروی شیمی درمانی بیان ژن پروتئین BCl-2 را کاهش داده که نشان دهنده اهمیت پروتئین های خانواده BCl-2 در بقای سلول سرطانی پستان است(32). در مطالعه ای اثر داروی دوکسوروبیسین بر بیان ژن های آپوپتوز BCl-2 قلب موش صحرایی مورد ارزیابی قرار گرفت. نتایج این مطالعه نشان داد که دارو فیبروز درون میوکارد را افزایش می دهد و موجب کاهش بیان ژن BCl-2 و افزایش بیان ژن BAX می گردد که با نتایج مطالعه حاضر هم­خوانی داشت(24). روند آپوپتوز توسط گروهی از پروتئین های متعلق به BCL-2 کنترل می شود. گروه پروتئین BCL-2 از پروتئین های ضد آپوپتوزی مانند BCL-2،XL-Bcl و پروتئین پیش آپوپتوزی مثل BAX تشکیل شده است. BAX پروتئین آغازگر آپوپتوز از طریق شکل گیری نفوذپذیری غشای میتوکندری است. در مقابل، BCL-2 عملکرد متضاد BAX ، مهار آپوپتوز و حفظ سلول ها را دارد. فعال سازی بیان BAX مانع از عملکرد BCL-2 می شود(20). گزارش شده است که کاهش معنادار در بیان پروتئین کاسپاز 3 در طی فعالیت هوازی با کاهش فاکتورهای پیش آپوپتوزی مانند بیان پروتئین BAX و نسبت BAX به Bcl-2 همراه می شود؛ که به عبارتی این مسئله به افزایش بیان پروتئین ضد آپوپتوزی Bcl-2 مربوط می شود. کاهش در پتانسیل آپوپتوزی میتوکندری طی فعالیت هوازی در موش های مسن ممکن است با کاهش رهایی فاکتورهای آپوپتوزی مانند سیتوکروم c در درون عضلات اسکلتی باشد که به طور معناداری بیان کاسپاز 3 را کاهش می دهد(6). ابراهیم پور و همکاران در پژوهشی به بررسی تاثیر فعالیت ورزشی قبل و بعد از ابتلا به سرطان پستان بر میزان BCl-2 در موش های ماده پرداختند. نتایج این تحقیق نشان داد که میزان BCl-2 در گروهی که فعالیت ورزشی هوازی انجام دادند در دوره قبل از ابتلا به سرطان نسبت به گروه کنترل افزایش معناداری را نشان داد. در حالی که در دوره بعد از القاء سرطان مقادیر BCl-2 کاهش یافت که با نتایج تحقیق حاضر همسو است. در سلول های سرطانی فاکتورهای آپوپتوتیک افزایش می یابد تا منجر به مرگ سلول سرطانی شوند و برعکس. در واقع در سلول های در معرض خطر انتخاب مرگ یا خودکشی برنامه ریزی شده سلول ها آخرین راه فرار از سرطانی شدن است. تخریب غشای هسته، سیتوپلاسم سلول و ارگانل ها منجر به قطعه قطعه شدن سلول می شود که سریعاً فاگوسیت ها بلعیده و از محیط ربوده می شوند(9). فعال سازی آپوپتوز از طریق عوامل شیمی درمانی انجام می شود که این عوامل در فعال سازی رسپتورهای آپوپتوز، اختلال در عملکرد میتوکندری و پردازش انزیم های پروتئولیتیک با کاسپازها درگیر می شوند(7). تنظیم کننده های اپوپتوز با انواع سرطان در انسان مرتبط هستند. مطالعات روی تومورهای انسانی نشان دادند که بین افزایش BCl-2 و کاهش بیان BAX با رشد غیرقابل کنترل تومور همبستگی مثبت وجود دارد(26، 15). هنگامی که ژن BCl-2 موجود بیش از حد باشد، سلول ها در برابر آپوپتوز محافظت می شوند. در مقابل زمانی که BCl-2 کاهش و BAX افزایش یابد، سلول ها در معرض مرگ برنامه ریزی شده قرار می گیرند(5). هم چنین از طرفی نتایج این مطالعه نشان داد که مصرف عصاره گزنه و تمرینات استقامتی بر سطح TNF- α در موش های مبتلا به سرطان ملانوما در گروه های مختلف کاهش معناداری دارد. سطح تغییرات بیان ژن  TNF-αبین گروه کنترل با گروه های تمرین و تمرین+عصاره و هم چنین گروه عصاره با گروه ترکیبی معنادار است. لی و همکاران مطالعه ای را برای بررسی اثر تمرین ورزشی بر شاخص های آپوپتوزیس انجام دادند. نتایج مطالعه بیانگر پایین بودن سطوح کاسپاز سه و نه و TNF-α در عضلات قلبی گروه تمرین نسبت به دو گروه دیگر بود(16). در تحقیقات گزارش شده است که اینترلوکین 6 در سرطان سینه و برخی سلول های توموری دیگر با افزایش Bcl-2 باعث افزایش مقاومت در مقابل اپوپتوز می شود(1). در تحقیق حاضر سطح اینترلوکین 6 اندازه گیری نشد؛ اما سطوح فاکتور نکروز تومور آلفا اندازه گیری شده است که سطوح آن در گروه تمرین و ترکیبی در مقایسه با گروه کنترل کاهش معناداری داشت؛ از آن جایی که تحقیقات نشان داده است که سطوح اینترلوکین 6 از طریق فعالیت ورزشی منظم کاهش می یابد(28). شواهد در حال رشد وجود دارد که فعالیت بدنی باعث تعدیل سرطان زایی ناشی از استروژن در سرطان پستان از طریق چندین مکانیسم بیولوژیکی قابل قبول می شود. بنابر این ورزش با کاهش سطوح استروژن می تواند منجر به افزایش آپوپتوز از طریق کاهش  Bcl-2شود. ممکن است اثرات حاد فعالیت ورزشی که باعث افزایش عوامل التهابی می شود منجر به عدم معناداری در کاهش میزان پروتئین Bcl-2 بوده باشد(37). یکی از موارد تشکیل دهنده عصاره گزنه از خاصیت آنتی اکسیدانی و ضد التهابی آن ها حاصل می شود. گزنه گونه های اکسیژن فعال را غیرفعال می کند، که می تواند آسیب رادیکال های آزاد پوست را کاهش دهد و بنابراین اثرات ضد پیری دارد(31، 30). توانایی القاء آپوپتوز در سلول های سرطانی و توقف تکثیر این سلول ها موضوع بسیاری از تحقیقات ایمونوفارماکولوژی می باشد. در تحقیق حاضر سطوح فاکتور التهابی TNF-α کاهش معناداری یافت که این روند کاهشی در گروه ترکیبی محسوس تر بود. این احتمال وجود دارد که یکی از مکانیسم های محتمل در کاهش Bcl-2 می تواند کاهش در فاکتورهای پیش التهابی از جمله اینترلوکین 6 و یا فاکتور نکروز تومور آلفا باشد. از طرفی Bcl-2 با جلوگیری از انتقال BAX از سیتوزول به میتوکندری میتواند منجر به کاهش BAX در میتوکندری شود(2) .نتایج تحقیق نشان داد که فعالیت بدنی منظم همراه با مصرف عصاره گزنه احتمالاً می تواند از طریق کاهش عوامل التهابی منجر به کاهش عوامل ضد آپوپتوزی و ایجاد آپوپتوز در سلول های سرطانی شود.

تشکر و قدردانی

 به این وسیله از جناب آقای دکتر عابد نظری که در اجرای این تحقیق با ما همکاری نمودند، تشکر می نمایم.

  1. 1. Alizadeh, AM., Heydari, Z., Rahimi, M., Bazgir, B., Shirvani, H., Alipour, S. (2017). Oxytocin mediates the beneficial effects of the exercise training on breast cancer. Iran J Basic Med Sci, 103(2); 222-35.

2.Amani Shalamzari, S., Agha-Alinejad, H., Alizadeh, Sh., Shahbazi, Sh., Kashani Khatib, Z., Kazemi, A. (2014). The effect of exercise training on the level of tissue IL-6 and vascular endothelial growth factor in breast cancer bearing mice. Iran J Basic Med Sci, 17(4); 231-58.

3.Amjadi, F., Javanmard, SH., Zarkesh-Esfahani, H., Khazaei, M., Narimani, M. (2011). Leptin promotes melanoma tumor growth in mice related to increasing circulating endothelial progenitor cells numbers and plasma NO production. J Exp Clin Cancer Res, 30; 21.

4.Campbell, K., Tiernan, A., Li, SS., Sorensen, BE., Yasui, Y., Lampe, JW. (2007). Effect of a 12- month exercise intervention on the apoptotic regulating proteins bax and Bcl-2 in colon crypts: A randomized controlled trial. Cancer Epidemiol. Biomarkers Prev, 16(9); 1767-74.

5.Childs, AC., Phaneuf, SL., Dirks, AJ., Phillips, T., Leeuwenburgh, C. (2002). Doxorubicin treatment in vivo causes cytochrome C release and cardiomyocyte apoptosis, as well as increased mitochondrial efficiency, superoxide dismutase activity, and Bcl-2:Bax ratio. Cancer Research, 62(16); 4592-4598.

6.Cory, S., Adams, J.M. (2002). The BcL2 family: Regulators of the cellular life-or-death switch. Nature Reviews Cancer, 2(9);  647-56.

7.Debatin, KM. (1997). Cytotoxic drugs, programmed cell death, and the immune system: defining new roles in an old play. Journal of the National Cancer Institute, 89(11); 750-751

8.Eliassen, AH., Hankinson, SE., Rosner, B., Holmes, MD., Willett, WC. (2010). Physical activity and risk of breast cancer among postmenopausal women. Arch Intern Med, 170(19); 1758-64.

9.Fesik, SW., Shi, Y. (2001). Structural biology. Controlling the caspases. Science, 294(5546); 1477-1478.

10.Finn, GJ., Creaven, BS., Egan, DA. (2004). A study of the role of cell cycle events mediating the action of comarian derivatives in human malignant melanoma cells. Cancer Letters, 214; 43-54.

11.Foo, JB., Yazan, LS., Tor, YS., Wibowo, A., Ismail, N., How, CW. (2015). Induction of cell cycle arrest and apoptosis by betulinic acid-rich fraction from Dillenia suffruticosa root in MCF-7 cells involved p53/p21 and mitochondrial signalling pathway. J Ethnopharmacol,166; 270-8.

12.Jafari, A., Pourrazi, H., Nikookheslat, S., Baradaran, B. (2015). Effect of exercise training on Bcl-2 and bax gene expression in the rat heart. Gene Cell Tissue, 2;4.

13.Konrad, L., Müller, H-H., Lenz, C., Laubinger, H., Aumüller, G., Lichius, JJ. (2000). Antiproliferative effect on human prostate cancer cells by a stinging nettle root (Urtica dioica) extract. Planta Med, 66(1); 44-7.

14.Kumar, V., Abbas, A., Aster, J. (2014). Robbins Pathologic Basis of Disease. 9th ed Tehran, Iran: Arjomand.

15.Lahmann, PH., Hoffmann, K., Allen, N., Van Gils, CH., Khaw, KT., Tehard, B. (2004). Body size and breast cancer risk: findings from the european prospective investigation into cancer and nutrition (EPIC). International Journal of Cancer, 111(5); 762-71.

16.Lee, S. D., Shyu, W. C., Cheng, I. S., Kuo, C. H., Chan, Y. S., Lin, Y. M. (2013). Effects of exercise training on cardiac apoptosis in obese rats. Nutrition, metabolism, and cardiovascular diseases. NMCD, 23(6); 566–573. https://doi.org/10.1016/j.numecd.2011.11.002.

17.Leite, V.C., Santos, RF., Chen, LC., Guillo, LA. (2004). Psoralen derivatives and longwave ultraviolet irradiation are active in vitro against human melanoma cell line. J Photochemistry and Photobiology, B; Biology, 76; 49-53.

18.Leung, LK., Wang, TT. (1999). Differential effects of chemotherapeutic agents on the Bcl-2/Bax apoptosis pathway in human breast cancer cell line MCF-7. Breast Cancer Research And Treatment, 55(1); 73-83.

19.Mantovani, G., Macciò, A., Mura, L. (2000). Serumlevels of leptin and proinflammatory cytokines in patients with advanced-stage cancer at differentsites. J Mol Med (Berl), 78; 554-61.

20.McIlwain, DR., Berger, T., Mak, TW. (2013). Caspase functions in cell death and disease. Cold Spring Harb Perspect Biol, 5(4); a008656.

21.Mirakhori, Z., Kordi, M., Alizadeh, SH., Gaieni, AA. The investigation of the preventive and therapeutic therapy assistance on the growth rate of the tumor, E2 and expression of 206-miR and ERα tumor tissue of breast cancer. Journal of Applied exercise Physiology, 11; 87-98.

22.Mousavi, S. M., Gouya, M. M., Ramazani, R., Davanlou, M., Hajsadeghi, N., Seddighi, Z. (2009). Cancer incidence and mortality in Iran. Annals of oncology: official journal of the European Society for Medical Oncology, 20(3); 556–563. https://doi.org/10.1093/annonc/mdn642

23.Moller, P., Wallin, H., Knudsen, LE. (1996). Oxidative stress associated with exercise, psychological stress and life-style factors. Chemico-Biological Interactions, 102(1); 17-36.

24.Mohammadi Gorji, S., Karimpour Malekshah, AA. (2013). Effect of doxorubicin on Bcl2 and Bax expression in rat heart. Journal of Gorgan University of Medical Sciences, 15(1); 19-24. [Persian].

25.Nahata, A., Dixit, V. (2012). Ameliorative effects of stinging nettle (Urtica dioica) on testosterone‐induced prostatic hyperplasia in rats. Andrologia, 44(s1); 396-409.

26.Namiki, M. (1990). Antioxidants/ antimutagens in food. Critical Reviews in Food Science & Nutrition, 29(4); 273-300.

27.Obertreis, B., Giller, K., Teucher, T., Behnke, B., & Schmitz, H. (1996). Antiphlogistische effekte von extractum urticae dioicae foliorum im vergleich zu kaffeoyläpfelsäure [anti-inflammatory effect of Urtica dioica folia extract in comparison to caffeic malic acid]. Arzneimittel-Forschung, 46(1); 52–56.

28.Otles, S., Yalcin, B. (2012). Phenolic compounds analysis of root, stalk, and leaves of nettle. The Scientific World Journal, 564367. https://doi.org/10.1100/2012/564367

29.Pal, SK., Shukla, Y. (2003). Herbal medicine: current status and the future. APJCP, 4(4); 281-8.

30.Shailajan, S., Hande, H., Singh, D., Tiwari, B. (2014). Estimation of ursolic acid from Urtica dioica L. using validated HPTLC method. Journal of Applied Pharmaceutical Science, 4; 092-095.

31.Siegel, RL., Miller, KD, Jemal, A. (2018). Cancer statistics. CA: A Cancer Journal for Clinicians, 68(1); 7-30.

32.Sharifi, S., Barar, J., Hejazi, MS., Samadi, N. (2015). Doxorubicin changes Bax /Bcl-xL ratio, caspase-8 and 9 in breast cancer cells. Advanced Pharmaceutical Bulletin, 5(3);351-359.

33.Smeltzer, SC., Bare, BG., Hinkle, JL., Cheever, KH. (2010). Brunner and Suddarth’s Textbook of Medical Surgical Nursing. 12th ed London, England: Wolters Kluwer, 205–231.

34.Vainshtein, A., Kazak, L., Hood, DA. (2011). Effects of endurance training on apoptotic susceptibility in striatedmuscle. J Appl Physiol, 110(6); 1638-1645.

35.Würstle, ML., Laussmann, MA., Rehm, M. (2012). The central role of initiator caspase-9 in apoptosis signal transduction and the regulation of its activation and activity on the apoptosome. Exp Cell Res, 318(11); 1213-1220.

36.Yan, D., Qin, N., Zhang, H. (2009). Expression of TNF-α leader sequence renders MCF-7 tumor cells resistant to the cytotoxicity of soluble TNF-α. Breast Cancer Res Treat, 116; 91-102.

37.Yvonne, M. (2008). Coyle physical activity as a negative modulator of estrogen-induced breast cancer. Cancer Causes Control, 19;1021- 9.