تاثیر عصاره چای سبز(Camellia sinensis) بر میزان بیان ژن های Bcl_2 و Bax در رده سلولی سرطانی معده AGS))

نوع مقاله : مقاله پژوهشی

نویسندگان

1 کارشناس ارشد ژنتیک، گروه بیولوژی، دانشکده علوم پایه، دانشگاه آزاد اسلامی واحد زنجان. زنجان. ایران.

2 استادیار،گروه بیولوژی ، دانشکده علوم پایه، دانشگاه آزاد اسلامی واحد زنجان.زنجان. ایران.

چکیده

زمینه و هدف: سرطان معده دومین علت مرگ به واسطه سرطان در جهان است. استفاده از داروهای گیاهی به علت داشتن عوارض جانبی کمتر اهمیت دارد. اثرات ضد سرطانی پلی فنول های کاتچین در چای سبز نقش کلیدی در پیشبرد سلول های سرطانی به آپوپتوز دارد. هدف از این مطالعه بررسی تغییرات بیان ژن های Bax و Bcl_2 در سلول ها AGS پس از تیمار با عصاره چای سبز است.
روش کار: غلظت های 800 , 1200 , 2000 μg/ml از عصاره چای سبز برسلولهای AGS  در 2 گروه 48 و 72 ساعت تیمار گردید. استخراج RNA، سنتز cDNA با استفاده از کیت انجام گردید. بررسی میزان بیان ژن های Bax و Bcl-2 با Real time PCR انجام شده و از ژن GAPDH به عنوان ژن رفرنس استفاده شد.
یافته ها: نتایج آنالیز داده های Real time PCR با روش 2- ΔΔCt افزایش معنی دار بیان نسبت ژن های    Bax / Bcl_2 در دوزهای 800 ، 1200 و 2000 μg/ml برای زمانهای 48 و 72 ساعت را نشان میدهد.  بیشترین افزایش این نسبت در غلظت 2000 μg/ml دیده شد.
نتیجه گیری: چای سبز موجب افزایش Bax/Bcl_2 وابسته به غلظت و زمان شده و این می تواند سلول سرطانی را به سمت مرگ سلولی برنامه ریزی شده سوق می دهد. این گیاه می تواند در روند درمان سرطان معده برای بیماران مبتلا به این سرطان، مفید واقع شود. البته برای درک مکانیسم عمل و نتایج دقیق تر، بایستی مطالعات برروی مدل حیوانی  و بالینی انجام گیرد.

کلیدواژه‌ها


عنوان مقاله [English]

Effect of Green Tea (Camellia sinensis) Extract on Bcl_2 and Bax Genes Expression in Gastric Cancerous Cell Line (AGS)

نویسندگان [English]

  • maryam Haghgoo Khomami 1
  • Zahra Deilami 2
1 IMsc, Faculty of Basic Science, Islamic Azad University, Zanjan Branch, Zanjan,Iran
2 Assistant professor, Faculty of Basic Science, Islamic Azad University, Zanjan Branch, Zanjan,Iran
چکیده [English]

Inroduction & Objective: Gastric cancer is second leading cause of cancer related death in the world. Use of herbal drugs because of having fewer side effects is of importance. The anticancer effects of catechin polyphenols in green tea have key role in promoting cancer cells to apoptosis. The aim of this study is to determine the changes in the expression rate of Bax and Bcl_2 genes in AGS cells after treatment with green tea extract.
Materials and Methods: Concentrations of 800, 1200, 2000  μg /ml of Green Tea extraction were treated in AGS cells as two groups 48 and 72 hours. Extraction of  RNA, synthesis of cDNA and the study of genes expression was performed by Real time PCR and also GAPDH gene was used as reference gene.
Results: The results of Real time PCR data analysis by 2- Ct method shows significant increase expression rate of  Bax / Bcl_2 genes in doses of 800, 1200 and 2000 μg / ml for times of 48 and 72 hours.
Conclusion: Green tea is the reason of increasing Bax/Bcl_2 ratio which it is dependent to concentration and time, and it can lead cancerous cell to programed cell death. This extract can be useful in the treatment of gastric cancer for patients with this cancer. To clarify the effective molecules and their mechanisms, further studies are undertaken on animal models and humans.

کلیدواژه‌ها [English]

  • Green tea
  • BAX
  • Bcl-2
  • AGS
  • gastric cancer

مقدمه

 

سرطان معده دومین عامل مرگ به واسطه سرطان لقب گرفته است. زمینه ژنتیکی ، سابقه فامیلی ، جهش ها و پلی مورفیسم ها ، عفونت هلیکوباکتری ، رژیم غذایی نامناسب و مصرف الکل از فاکتورهای تاثیرگذار در ایجاد و پیشرفت این بیماری می باشد(1،2). مسیری وابسته به میتوکندی برای ایجاد آپوپتوز وجود دارد که توسط پروتئین های خانواده Bcl_2 کنترل میگردد . دو گروه از پروتئین های خانواده Bcl_2 شامل ضد آپوپتوز(Anti apoptotic) و پیشرونده به آپوپتوز (Pro apoptotic) وجود دارد. حساسیت سلول به آپوپتوز یا ادامه بقاء آن به تعادل فاکتورهای  پروآپوپتوزی و ضد آپوپتوزی بستگی دارد. ژن Bcl_2 به عنوان یک پروتوانکوژن درغشاء میتوکندری و پوشش هسته و در ارتباط با شبکه آندوپلاسمی شناخته شده است و با جلوگیری از خروج سیتوکروم C از غشاء میتوکندری باعث توقف مرگ برنامه ریزی شده سلول ها می شود. پروتِئین Bax در سیتوزول قرار دارد که طی آپوپتوز مکان آن از سیتوزول به سمت میتوکندری تغییر کرده و تغییراتی در نفوذ پذیری غشاء خارجی ایجاد می کند که سبب تورم و پاره شدن آن و آزاد شدن سیتوکروم C از غشاء داخلی میتوکندری به سیتوزول می شود(3،4). مطالعات متعددی به نقش ژن های Bax و Bcl_2 در ایجاد سرطان معده اشاره کرده است. از جمله آن می توان به نتایج مطالعه کونتورک (Konturek) در  بررسی پروتئین های Bax و Bcl_2 در بیماران مبتلا به سرطان معده اشاره کرد که نشان می دهد که کاهش بیان ژن Bax در گروه های بیمار ، حاکی از اختلال در تنظیم بیان موجب سرطانی شدن سلول معده می شود(5). نتایج تحقیقات دانشمندان نشان می دهد که نسبت Bax/Bcl_2 تعیین کننده ادامه مسیر سلول است. گیاهان دارویی و ترکیبات آنها که دارای خواص ضد سرطانی هستند ، می توانند در درمان بیماری سرطان مفید باشند. آزمایشات مختلفی در راستای تاثیر عوامل دارویی گیاهی و اجزاء آن بر سلول­های سرطانی معده انجام شده است. به طور مثال ، آزمایش تاثیر کرایزین  که از درختان و عسل استخراج می شود بر رده سلولی AGS که توسط امینی انجام شد ، نشان داد که فعالیت ضد تکثیری بر سلول های سرطانی معده دارد(6). چای سبز تولید شده از برگ های گیاه کاملیل سیننسیس (Camellia sinensis) یک نوشیدنی بسیار محبوب در سراسر جهان است. پلی فنول­های چای سبز به دلیل داشتن خواص ضدسرطانی اثرات پیشگیرانه ای در بسیاری از سرطان ها دشته ، همچنین در درمان دیابت ، پارکینسون ، سکته مغزی ، آلزایمر و چاقی مفید هستند. پلی فنول های مهم چای سبز , اپی کاتچین (EC) (Epicatechin) ، اپی گالوکاتچین (EGC) (Epigallocatechin) ، اپی کاتچین-3-گالات (ECG) (Epicatechin-3-gallate) و اپی گالو کاتچین-3-گالات (EGCG) (Epigallocatechin-3-gallate) است(7،8). از مطالعاتی که در راستای عملکرد اجزاء گیاه چای سبز انجام شد. مطالعه جی کین (Jie Qin) با تاثیر EGCG بر رده سلولی T24 سرطان مثانه نتایج سودمندی را در پی داشت که از جمله آن می توان به مهار رشد سلول سرطانی با تاثیر EGCG اشاره نمود(9).با در نظر گرفتن خواص گیاه چای سبز و اثرات ضدسرطانی آن آزمایشی در راستای تیمار این عصاره به سلول های سرطانی معده انجام شد. با توجه به اینکه نسبت بیان ژن Bax به ژن Bcl_2 (Bax/Bcl_2) نقش مهمی در تعیین سرنوشت سلول به سمت آپوپتوز و یا مانع از آن دارد ، تغییرات میزان بیان ژن های Bax و  Bcl_2 ، با روش Real time PCR بررسی گردید.

مواد و روش ها

عصاره گیری چای سبز

در ابتدا گیاه چای سبز  که در بهار سال 1394 از فروشگاه های معتبر خریداری شده بود، در آزمایشگاه زیست شناسی گیاهی توسط متخصص محترم گیاه شناسی دانشگاه آزاد اسلامی واحد زنجان از نظر خلوص مورد شناسایی و تایید قرار گرفت. سپس عمل عصاره گیری به روش ماسراسیون (خیساندن) انجام گرفت. 50 گرم از پودر گیاه چای سبز در 500 میلی لیتر آب مقطر استریل مخلوط گردید. ارلن مذکور جهت حل شدن پلی فنل های چای سبز، 15 دقیقه در دمای جوش بن ماری قرار گرفته و سپس بر روی شیکر انکوباتور گذاشته شد. پس از گذشت 24 ساعت، ناخالصی های محلول توسط گاز استریل 4 لایه و قیف و پس از آن با دستگاه سانتریفوژ جدا شده و با استفاده از دستگاه روتاری تغلیظ گردید(10).

کشت و تیمار سلول های AGS

یک فلاسک T25 حاوی سلول های AGS از مرکز ملی ذخایر ژنتیکی و زیستی ایران خریداری گردید.  بلافاصله سلول ها در محیط کشت کامل شامل  DMEM ، 10% FBS و 1% آنتی بیوتیک (pen/strep) ساب کالچر شدند. در ادامه پس از شمارش سلولی، تعداد 105 سلول در هریک از چاهک های پلیت های 12 چاهکی ، کشت داده شده و پس از اتصال سلولها، تیمار عصاره چای سبز آغاز گردید.  یک از چاهک ها به عنوان کنترل و چاهک‌های دیگر با غلظت های 800 ، 1200 و 2000 میکروگرم بر میلی لیتر از عصاره چای سبز تیمار گردید (11). سلول ها پس از تیمار  به مدت 48 و 72 ساعت، تریبسینه و جمع آوری شدند. لازم به ذکر است که تمام آزمایشات کشت سلولی

 استخراج RNA و سنتز cDNA

استخراج RNA آن ها طبق پروتکل استخراج RNA (RNX-Plus سیناژن)   ، انجام شد. رسوب سلول ها در 1 میلی لیتر از محلول (CinnaGen) RNX-Plus اضافه شد و مدت 10 تا 15 دقیقه در دمای اتاق قرار داده شدند. سپس به هر نمونه مقدار 200 میکرولیتر کلروفرم افزوده شد وبعد از 5 دقیقه در دورrpm  13000 به مدت 15 دقیقه سانتریفوژ شدند. محلول رویی به آرامی برداشته شد و هم حجم آن ایزوپروپانول(Merck)  اضافه و کاملاً مخلوط و سپس در دور rpm 13000 سانتریفوژ شدند. در انتها رسوب حاصل در 50 میکرولیتر آب مقطر دیونیزه اتوکلاو شده حل شد. برای تعیین مقدار و کیفیت استخراج RNA اندازه گیری جذب نوری (Optical Density: OD) توسط فتومتر ،(Eppendorf) انجام شد.  یک میکروگرم از RNA استخراج شده برای سنتز cDNA با استفاده از کیت سنتز   cDNA(Bioneer)  به کار رفت.

مطالعه میزان بیان ژن Bax  و BCL-2

به منظور بررسی میزان بیان ژن های Bax  و Bcl-2  در سلول های  AGSپس از تیمار، از کیت (QIAGEN) QuantiFast SYBR Green و دستگاه Real time PCR  (QIAGEN) استفاده شد. واکنش ها از نوع کمی-نسبی (Relative quantification) انجام شد که در آن ژن هدف در مقایسه با بیان یک ژن خانه دار(House keeping)  (Glyceraldehyde 3-phosphate dehydrogenase) GAPDH به عنوان کنترل داخلی مقایسه شد؛ سپس از فرمول زیر برای محاسبه بیان ژن استفاده شد:

ΔCt(control)=  (Ct Target gene - Ct Reference gene)     

 و   ΔCt(Treatment)=  (Ct Target gene - Ct Reference gene)     

ΔΔCt=  (ΔCt treatment - ΔCt Control)     

Relative fold change = 2-Ct

پرایمرهای ژن های Bax و   Bcl_2 و ژن کنترل داخلی  GAPDH ، از مقالات معتبر استخراج گردید(12،13). واکنش Real time PCR  به صورت دوتایی   (Duplicate)  با بکار گیری cDNA های سنتز شده و سایبرگرین انجام شد . در این مرحله هر کدام از میکروتیوپ ها با  20 نانوگرم cDNA ، 10 μM از پرایمرها با 5/12 میکرولیتر از کیت  RealQ plus  حاوی سایبر گرین   آماده شد.  دما و شرایط Real time PCR به صورت زیر خواهد بود: گرمادهی اولیه 95 درجه سا نتی گراد به مدت 10 دقیقه که طی این مرحله Taq پلیمراز شروع داغ (Hot start Taq polymerase) فعال می شود. در هر چرخه دمای 95 درجه سانتی گراد به مدت 10 ثانیه، دمای 60 درجه سانتی گراد به مدت 30 ثانیه بود که طی40 چرخه ادامه داشت. با استفاده از سایبرگرین (Syber green) میزان آمپلی فیکاسیون (Amplification) در هر چرخه دنبال شد. رنگ سایبر گرین با اتصال به DNA دو رشته ای علامت فلورسانت ساطع می کند. در چرخه ای که واکنش تکثیر وارد مرحله لگاریتمی می شود، که تحت عنوان Ct (Threshold cycle) گفته می شود میزان افزایش محصولات اندازه گیری میشود(13). بررسی معنی‌داربودن  نتایج توسط آزمون t-test انجام شد.  آزمایشا ت برای هرکدام از تیمارهای زمانی 48 و 72 ساعت حداقل سه بار تکرار شدند و در شکل 1 نمونه ای از منحنی های Real time PCR آورده شده است .P-value ذکر شده از مقایسه میانگین و انحراف معیار ژن های Bax و Bcl_2 در مقایسه با گروه کنترل و همچنین مقایسه میانگین و انحراف معیار ژن Bax با میانگین و انحراف معیار ژن Bcl_2 (Bax/Bcl_2)  با 3 بار تکرار به دست آمده است.

نتایج

تصویری از سلول های AGS درشکل 1 آمده است. تیمار سلول های AGS با غلظت های مختلف عصاره چای سبز با سه بار تکرار انجام شد .  تیمار سلول های AGS، با عصاره چای سبز در سه غلظت 800 ، 1200 و 2000 μg/ml در دو بازه زمانی 48 و 72 ساعت، برمیزان بیان ژن های Bax و Bcl_2 تاثیر گذاشته است. شکل 2 نمونه ای از منحنی های Real time PCR  مربوط به بیان  ژن Bax  و Bcl-2 می باشد. جدول 1 و شکل 3 میزان تغییرات بیان ژن های Bax  و Bcl-2 و نسبت Bax/Bcl-2 را نشان می دهد.میزان بیان ژن Bax نسبت به گروه کنترل، دارای افزایش می باشد، به طوری که بیشترین افزایش بیان، در هر دو تیمار زمانی 48 و 72 ساعت، در غلظت 2000 μg/ml  می باشد.  همچنین عصاره چای سبز در کاهش  بیان ژن Bcl_2 موثر بوده و با افزایش غلظت عصاره و افزایش زمان تیمار(2000 میکروگرم بر میلی لیتر و 72 ساعت تیمار)،  بیشترین میزان کاهش بیان مشاهده گردید. پس می توان این گونه نتیجه گرفت که میزان بیان این ژن تحت تاثیر غلظت عصاره  و مدت زمان تیماربوده است .

 

جدول 1-  توالی پرایمرهای استفاده شده جهت تکثیر ژن های IGF-I و 2m در ماهی قزل آلای بومی و غیر بومی پرورشی

 

ژن

 

توالی پرایمر’۵ ’۳

طول محصول (bp) PCR

GAPDH

'5- ACCCAGAAGACTGTGGATGG

TCTAGACGGCAGGTCAGGTC -3' 

 (35) 466

 

Bcl-2

'5- TTGTGGCCTTCTTTGAGTTCGGTG

GGTGCCGGTTCAGGTACTCAGTCA -3'   

 (35) 127

 

Bax

CCTGTGCACCAAGGTGCCGGAACT-5

CCACCCTGGTCTTGGATCCAGCCC-3

 

 

 

 

 

شکل 1- نمونه ای از سلول های AGS بزرگ نمایی X10با میکروسکپ معکوس(Invert).

 

 

 

نمودار 2- نمونه ای از منحنی های Real time PCR مربوط به میزان بیان ژن Bax  و Bcl-2 در رده سلولی AGS می باشد.

الف) منحنی مربوط به میزان بیان ژن Bax و ب) منحنی مربوط به میزان بیان ژن Bcl-2. محور افقی مربوط به تعداد چرخه های PCR و محور عمودی مربوط به میزان افزایش فلورسانس سایبرگرین است. میزان بیان ژن های Bax  و Bcl-2  با استفاده از فرمول2 –ΔΔC t        محاسبه گردید.

 

 

 

الف)

ب)

نمودار2- نمودار ستونی نسبت میزان بیان ژن­های Bax و Bcl_2 در بازه 48ساعت (الف) و بازه زمانی 72ساعت (ب) .

بیشترین میزان افزایش بیان ژن Bax و کاهش بیان Bcl-2 در غلظت 2000 میکرو گرم بر میلی لیتر و تیمار 72 ساعت مشاهده گردید.

 

 

 

جدول2-بررسی تغییرات نسبت بیان ژن­های  Bax و Bcl_2 و نسبت ژن Bax به ژن Bcl_2 (Bax/Bcl_2) بر اساس2-ΔΔCT در بازه زمانی  48 ساعت( الف ) و  بازه زمانی 72 ساعت (ب)  (05/0P-value ).

P-value Bax/Bcl2

 

Bax/Bcl2

Ratio

 

 

P-value Bcl2

 

2-ΔΔCT

Bcl-2 gene

 

 

P-value Bax

 

2-ΔΔCT

Bax gene

 

48 hrs

Treatment

-

1

-

1

-

1

Control

0.042

1.075

0.000061

1.21

0.00015

1.28

800μg/ml

0.000

1.320

0.0016

1.15

0.000013

1.52

1200μg/ml

0.000

1.61

0.000031

1.08

0.000051

1.75

2000μg/ml

 

P-value Bax/Bcl2

 

Bax/Bcl2

Ratio

 

 

P-value Bcl2

 

2-ΔΔCT

Bcl-2 gene

 

 

P-value Bax

 

2-ΔΔCT

Bax gene

 

72 hrs

Treatment

-

1

-

1

-

1

Control

0.000

1.20

0.000

1.11

0.000

1.34

800μg/ml

0.000

1.48

0.000

1.06

0.000

1.58

1200μg/ml

0.014

1.79

0.021

1.04

0.000

1.87

2000μg/ml

 

 

با افزایش غلظت عصاره چای سبز میزان بیان ژن Bax   و Bcl-2 تغییر می یابد و افزایش نسبی میزان بیان ژن Bax باعث افزایش نسبت Bax/Bcl-2 می گردد. بیشترین افزایش این نسبت در غلظت 2000 میکروگرم بر میلی لیتر و تیمار زمانی 72 ساعت حدود 2 برابر، می باشد .نسبت میزان بیان دو ژن  Bax/Bcl-2بسیار مهم و تعیین کننده سرنوشت سلولی است.  عصاره چای سبز باعث افزایش نسبت بیان Bax/Bcl_2 در گروه­های 48 و 72 ساعت شده و این تغییر میزان بیان ، سلول سرطانی را به سمت آپوپتوز پیش می­برد. دربین غلظت­های مورد مطالعه ،  بیشترین افزایش این نسبت در غلظت 2000 μg/ml دیده شد

بحث و نتیجه گیری

 مطالعات بسیاری در جهت اثبات ژن های  Baxو Bcl-2 به عنوان ژن های کلیدی در ایجاد بسیاری از سرطان ها از جمله سرطان معده انجام گرفته است.   تکثیر سلولی و بیان ژن های Bax و Bcl-2 در کارسینومای معده نشان داده که نسبت بیان این دو ژن در سلول های سرطانی تغییر کرده و افزایش میزان ژن Bcl-2 و کاهش میزان ژن Bax از دلایل مهم ایجاد سرطان معده می باشد(14) از این رو عوامل یا داروهایی که باعث افزایش نسبت Bax/Bcl-2 شود، مورد توجه می باشند.   عصاره های گیاهی با خاصیت ضد سرطانی، به دلیل عوارض جانبی بسبار کم همواره مورد توجه بوده اند. در بین آنها از خواص سودمند چای سبز نمی توان اجتناب کرد. عصاره چای سبز ، دارای خاصیت ضدسرطانی بوده که با آزمایشات گوناگون بر بیماران سرطانی و رده های سلول سرطانی اثبات گشته است(15). اواکواژنی (Evacuasiany) و همکارانش اثرات سایتوتوکسیک و فعالیت‌های آنتی اکسیدانی کاتچین ها که در عصاره چای سبز موجود می باشد، را در چند رده  سلولی سرطانی پستان (T47Dو(MCF7 بررسی کرده فعالیت ضدسرطانی آن را نشان داده اند(15).در مطالعه حاضر ، تاثیر عصاره چای سبز، در رده سلولی سرطانی معده (AGS) ، درغلظت های 800 ، 1200 و 2000 μg/ml   و دو تیمار زمانی 48 و 72 ساعت بررسی گردید. خاصیت ضد سرطانی عصاره چای سبز با مطالعه تاثیر آن برمیزان بیان ژن های Bax (پیش برنده آپوپتوز)و  Bcl-2 (مهارکننده آپوپتوز) انجام شد.  افزایش نسبت بیان Bax/Bcl_2 بیانگر پیشرفت سلول به سمت آپوپتوز خواهد بود.  نتایج مطالعه بیانگر افزایش این نسبت در تمام غلظت ها و تیمار های زمانی می باشد و  بیشترین افزایش در غلظت 2000 μg/ml و تیمارزمانی72 ساعت می باشد. به این ترتیب می توان نتیجه گرفت که نسبت بیان Bax/Bcl_2 تحت تاثیر غلظت عصاره و مدت زمان تیمار قرار گرفته است. ژن Bax  به عنوان پیش برنده آپوپتوز، در تمام غلظت ها به ویژه 2000 μg/ml افزایش بیان را نشان می دهد که این افزایش بیان از میزان بیان ژن Bcl-2  (عامل بقای سلولی) ببیشتر می باشد.  به این ترتیب  چون نسبت  Bax/Bcl-2  در کل افزایش یافته است، می توان چنین استنباط کرد که سلول های سرطانی بیشتر به سمت آپوپتوز پیش خواهند رفت. عملکرد عصاره با میزان غلظت آن و زمان تیمار رابطه مستقیمی داشته و با تغییر در این دو فاکتور ، میزان بیان ژن ها نیز تغییر می یابد. در نهایت با افزایش نسبتBax/Bcl_2  ، آپوپتوز در سلول های AGS نیز افزایش خواهد یافت.  در این راستا می توان به مطالعات مشابه دیگر اشاره کرد.  جون ما (Jun Ma) و همکارانش در تیمار سلول های AGS با EGCG (از اجزا چای سبز)  بقا و مرگ سلولی را ارزیابی کرده و عنوان کردند که EGCG موجود در عصاره چای سبز فرآیند آپوپتوز و مهار تکثیر در سلول­های AGS را ارتقا می دهد (16). در مطالعه‌ای دیگر ، نیشی کاوا (Nishikawa) تیمار EGCG  بر رده سلولی HCC (ازرده کارسینومای کبدی) را انجام داده و گزارش کرد که EGCG رشد این سلول های سرطانی را مهار کرده همچنین با افزایش غلظت آن بیان ژن های Bcl_2 و Bcl_XL کاهش یافته است(17). مطالعات مشابه با گیاهان دارویی  دارای خواص ضدسرطانی دیگر نیز، نتایج مشابهی در تغییر نسبت بیان Bax/Bcl_2 نشان داده است. همچنین مفهوم افزایش بیان نسبت Bax/Bcl_2 بیانگر این مهم می باشد  که می توان از عصاره های گیاهی در غلظت ها و زمان موثر جهت بهبود روند درمان بیماران سرطانی  استفاده نمود. به طور مثال می توان به نتایج مطالعه هوشیار (Hoshyar) در زمینه تغییرات بیان نسبت Bax/Bcl_2 پس از تیمار کروسین که از اجزاء زعفران بوده بر رده سلولی AGS اشاره کرد. نتایج آنها نشان داد که مکانیسم اجزاء گیاه این گیاه دارویی موجب افزایش این نسبت و پیشروی سلول به سمت آپوپتوز می شود(18). با این حال هنوز جزییات دقیق تری در عملکرد اجزاء گیاهان دارویی بر تغییرات بیان ژن های درگیر در سرطان ها باقی مانده که نیازمند مطالعات و آزمایش های بیشتری در این راستا است زیرا استفاده از گیاهان دارویی بر پایه اطلاعات و عملکرد علمی آنها به دلیل نداشتن عوارض جانبی جهت درمان بیماری های شایع  امروزه ، بسیار مفید می باشد.به طور کلی با استناد به نتایج مطالعه حاضر و مشابه می توان گفت، چای سبز می تواند بر بیان ژن‌های دخیل در سرطان معده موثر باشد که این تغییرات بیانی موچب مرگ سلول سرطانی می شود. نتایج به دست آمده می تواند مورد استفاده شرکت های دانش بنیان برای تولید داروهای گیاهی با عصاره چای سبز در جهت کنترل و بهبود پیشرفت بیماران مبتلا به سرطان معده قرار گیرد.

تشکرو قدردانی

از ریاست محترم آزمایشگاه علوم و تحقیقات وهمچنین از مدیر محترم گروه ژنتیک دانشگاه آزاد اسلامی واحد زنجان سپاسگزاری می گردد.

1.Aceto, N,, Duss , S., MacDonald, G., Meyer, DS., Roloff, T-C., Hynes, N E. (2012). Co-expression of HER2 and HER3 receptor tyrosine kinases enhances invasion of breast cells via stimulation of interleukin-8 autocrine secretion. Breast Cancer Research, 14(5); R131.
2.Antonsson, B., Martinou, J-C. (2000). The Bcl-2 Protein Family. Experim Cell Research, 256(1);50-7.
3.Amini Sarteshnizi, N., Teimori, H., Zahri, S., Mobini Dehkordi, M., Khosravi, S., Amini Sarteshnizi, R. (2015). Effect of Chrysin on AGS human gastric cancer cell line. J Gorgan Univ Med Sci, 16(4);  63-8.
4.Evacuasiany, E., Ratnawati, H., Liana, L K., Widowati, W., Maesaroh, M., Mozef ,T. (2014). Cytotoxic and antioxidant activities of catechins inhibiting the malignancy of breast cancer, Oxid Antioxid Med Sci, 3(2); 141-6.  
5.Hoshyar, R., Bathaie, SZ., Sadeghizadeh, M. (2013). Crocin triggers the apoptosis through increasing the Bax/Bcl-2 ratio and caspase activation in human gastric adenocarcinoma, AGS, cells. DNA Cell Biol, 32(2); 50-7.
6.Hosainzadegan, H. , Ezzetpor, B. , Abdollahpor, F., Motamedy, M., Rashidipor, M . (2010). Study of cytotoxic activity of olive and green tea extracts on breast tumor cell line. J Ardabil Univ Med Sci, 10(4); 287-94. (persian)
7.Iravani, SH.(2013). Gastric cancer as a multifactorial disease. J Army Univ Med Sci., 11(2); 157-64. (persian)
8.Khosravi, A., Farid Hoseini, R., Jabbari Azad, F., Yousofzadeh, H., Moghiman, T., Vaez Tabasi, M. (2013). Inhibitory effects of saffron extract in preventing growth of colon adenocarcinoma cancerous cells. Medic J Mashhad Uni., 56(5);283-8. (persian).
9.Konturek, PC., Konturek, SJ., Sulekova, Z., Meixner, H., Bielanski, T., Starzynska, T.(2001).  Expression of hepatocyte growth factor, transforming growth factor alpha, apoptosis related proteins Bax and Bcl-2, and gastrin in human gastric cancer. Aliment Pharmacol Ther., 15(7); 989-99.
10.Koshida, Y., Saegusa, M., Okayasu, I. (1997). Apoptosis, cell proliferation and expression of Bcl-2 and Bax in gastric carcinomas: immuno histo chemical and clinico pathological study. British Journal of Cancer,75(3); 367.
11.Ma, J., Shi, M., Li, G., Wang, N., Wei, J., Wang, T. (2006). Regulation of Id1 expression by epigallocatechin‑3‑gallate and its effect on the proliferation and apoptosis of poorly differentiated AGS gastric cancer cells. International Journal of Oncology, 43;1052-8. 
12.Nishikawa, T., Nakajima, T., Moriguchi, M., Jo, M., Sekoguchi, S., Ishii, M.  (2006). A green tea polyphenol, epigalocatechin-3-gallate, induces apoptosis of human hepatocellular carcinoma, possibly through inhibition of Bcl-2 family proteins. Journal of Hepatology, 44(6); 1074-82.
13.Paul-Samojedny, M., Kokocin´ska, D., Samojedny, A., Mazurek, U., Partyka, R., Lorenz, Z. (2005). Expression of cell survival/death genes: Bcl-2 and Bax at the rate of colon cancer prognosis. BBA, 1741(1-2); 25-9.
14.Phukan, RK., Narain, K., Zomawia, E., Hazarika, NC., Mahanta, J.(2006). Dietary habits and stomach cancer in Mizoram, India. J Gastroenterol, 41(5); 418-24.
15.Qin,. J, Xie, L-P., Zheng, X-Y., Wang, Y-B., Bai, Y., Shen, H-F. (2007). A component of green tea, epigallocatechin-3-gallate, promotes apoptosis in T24 human bladder cancer cells via modulation of the PI3K/Akt pathway and Bcl-2 family proteins. BBRC, 354(4); 852-7.
16.Reed, J.C.(2000). Mechanisms of apoptosis. AJP, 157(5); 1415-30.
17.Singh, BN., Shankar, SH., Srivastava, RK. (2011). Green tea catechin, epigallocatechin-3-gallate (EGCG): Mechanisms, perspectives and clinical applications. Biochem Pharmacol, 82(12);1807-21.
18.Wang, YC., Bachrach, U.(2002). The specific anti-cancer activity of green tea epigallocatechin-3-gallate (EGCG). Amino Acids, 22(2); 131-43.