اثر افزودن بایوترونیک تاپ3 به جیره بر شاخص‌های رشد، ایمنی موکوس و خون و بیان ژن‌های مرتبط رشد (GH, Ghrelin, IGF-1) در تاسماهی ایرانی (Acipenser persicus)

نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه تکثیر و پرورش آبزیان، دانشکده شیلات و محیط زیست، دانشگاه علوم کشاورزی و منابع طبیعی گرگان

2 دانشیار، گروه شیلات، دانشکده منابع طبیعی، دانشگاه علوم کشاورزی و منابع طبیعی گرگان.

چکیده

زمینه و هدف: بایوترونیک تاپ3 یکی از مکمل های خوراکی موجود در بازار است که محصولی اسیدی ‌فایری و یک محصول تجاری است که برای کنترل باکتری‌های بیماری‌زا استفاده می‌شود. هدف از انجام این تحقیق، بررسی اثرات بایوترونیک تاپ3 بر برخی از شاخص های رشد، ایمنی موکوس و سرم و بیان ژن های دخیل در رشد تاسماهی ایرانی(Acipenser persicus) بود.
روش کار: تعداد 240 قطعه تاسماهی ایرانی(با میانگین وزنی 1±104 گرم) از مرکز تکثیر و پرورش ماهیان خاویاری شهید مرجانی واقع در شهرستان ساری خریداری شد. ماهیان پس از گذشت 2 هفته به منظور سازگاری با شرایط آزمایشی تحت سه تیمار آزمایشی با سطوح مختلف بایوترونیک تاپ3 شامل:2، 4 و 8گرم به ازای کیلوگرم جیره و یک گروه شاهد به مدت 8 هفه تغذیه شدند. در انتهای دوره، جهت بررسی شاخص های رشد زیست سنجی انجام شد. هم چنین برای سنجش شاخص های مربوط به ایمنی موکوس و سرم به ترتیب عملیات موکوس گیری و خون گیری از ماهیان به طور کاملاً تصادفی صورت گرفت. جهت سنجش میزان بیان ژن های دخیل در رشد نمونه گیری از تمامی تیمارها به طور تصادفی انجام شد.
یافته ها: نتایج نشان داد که بهترین عملکرد رشد و بیشترین میزان بیان ژن های دخیل در رشد (GH، IGF-1 و Ghrelin0) در گروه شاهد وجود داشت (05/0 >P). بیشترین میزان آلکالین فسفاتاز و پروتئین کل موکوس و پروتئین کل سرم و کمترین میزان آلانین ترانس آمیناز سرم در تیمار تغذیه شده با جیره حاوی 8 گرم بایوترونیک تاپ3 در کیلوگرم جیره وجود داشت که با گروه شاهد اختلاف معنادار داشت (05/0 >P). جیره های حاوی بایوترونیک تاپ3، فعالیت آنزیم لیزوزیم موکوس و آسپارتات ترانس آمیناز سرم را به طور قابل توجهی به ترتیب افزایش و کاهش دادند که با گروه شاهد اختلاف معنادار بود (05/0 >P). میزان گلوکوز و آلکالین فسفاتاز سرم خون در تمامی تیمارها با گروه شاهد اختلاف معناداری نداشت (05/0 <P).
نتیجه گیری: به طور کلی، جیره غذایی حاوی 8 گرم بایوترونیک تاپ3 در کیلوگرم غذا، علی رغم عدم اعمال اثر روی شاخص های رشد، باعث بهبود پارامترهای ایمنی موکوس و سرم تاسماهی ایرانی شد.

کلیدواژه‌ها


عنوان مقاله [English]

Effect of dietary supplemented biotronic top3 on growth indices, mucus and blood serum immunity and the expression of growth-related genes (GH, Ghrelin, IGF-1) in Persian sturgeon (Acipenser persicus)

نویسندگان [English]

  • Abdulsalam Hatami 1
  • Hamed Paknejad 1
  • Mohammad Sudagar 2
1 the Department of Aquaculture, Faculty of Fisheries and Environment, Gorgan University of Agricultural Sciences and Natural Resources
2 Department of Aquaculture, Faculty of Fisheries and Environment, Gorgan University of Agricultural Sciences and Natural Resources
چکیده [English]

The aim of this study was investigation of effects of biotronic top3 on some growth indices, mucus and serum immunity and expression of genes involved in growth of Persian sturgeon .
240 fish (with an average weight of 104±1 g) were fed for 8 weeks under three experimental diets with different levels of biotronic top3, including: 2, 4 and 8 g / kg diet and a control group. At the end of the period, sampling was done randomly to evaluate the growth indices, mucosal and serum immunity as well as the expression of genes involved in growth.
The results showed that the best growth performance and the highest expression of genes involved in growth (GH, IGF-1 and Ghrelin) were presented in the control group (P <0.05). The highest amount of alkaline phosphatase, total mucus protein and total serum protein and the lowest amount of serum alanine transaminase were presented in the treatment fed with diet containing 8 g biotronic top3 / kg of diet, which was significantly different from the control group (P <0.05). Diets containing biotronic top3 significantly increased and decreased serum lysozyme mucus and aspartate transaminase activity, respectively, which was significantly different from the control group (P <0.05). There was no significant difference in serum glucose and alkaline phosphatase levels in all treatments with the control group (P <0.05).
Diet containing 8 g of biotronic top3 / kg diet, despite not having an effect on growth indices, improved the mucus and serum immunity parameters in Persian sturgeon .

کلیدواژه‌ها [English]

  • Persian sturgeon (Acipenser persicus)
  • biotronic top3
  • Growth indices
  • mucus and serum immunity
  • Gene expression

مقدمه

 

در سال های اخیر استفاده از مکمل های خوراکی جهت بهبود پاسخ سیستم ایمنی آبزیان و یا کنترل شدت و شیوع بیماری بسیار موثر بوده است(49، 48). از سویی دیگر، یکی از اساسی ترین اهداف آبزی پروری، کاهش قیمت غذای مصرف شده، استفاده از غذاهایی با کیفیت، صرفه اقتصادی و کاهش ضریب تبدیل غذایی می­باشد(12). در حال حاضر آبزی پروری سریع ترین رشد را در بخش های تولید مواد غذایی داشته و از چندین دهه گذشته به سرعت به یک صنعت پویا و رو به رشد تبدیل شده است. در حال حاضر چالش عمده در آبزی پروری، بهبود جیره های غذایی فرموله شده برای بهبود سیستم ایمنی آبزیان می باشد(7). این افزایش تولید نیازمند استفاده از خوراک های با کیفیت و حاوی مقادیر بالای پروتئین می باشد. بنابراین، علاوه بر مواد مغذی اصلی(پروتئین، چربی، کربوهیدرات و غیره)، بایستی مواد افزودنی مکمل جهت سلامتی و رشد مطلوب به جیره آبزیان افزوده شود(61). هم چنین، افزایش تولید سیستم­های آبزی‌پروری، ماهی را در معرض استرس های متعدد مانند: کیفیت پایین آب، تراکم زیاد، دست کاری و حمل و نقل قرار می دهد که ممکن است تأثیر منفی روی وضعیت ایمنی و بهداشت ماهیان داشته باشد. ضعیف شدن سیستم ایمنی توسط استرس های محیطی می تواند منجر به مستعد شدن ماهیان برای ابتلا به بیماری ها شود، که تولید اقتصادی سیستم های آبزی پروری را محدود می­کند(64). از طرفی، زنده مانی ماهیان در مراحل اولیه زندگی از مهم ترین معضلات پرورش دهندگان ماهی است، لذا تقویت و ارتقاء سیستم ایمنی و دفاعی بدن بچه ماهیان به ویژه در گونه های پرورشی از اصلی ترین نیازهای صنعت آبزی پروری محسوب می گردد(46). بر اساس مطالعات انجام شده، استفاده از اسیدهای آلی در جیره غذایی ماهی و میگو می تواند روش مناسبی در تولید محصولات پروتئینی سالم و با توجیه اقتصادی محسوب گردد(35). برای مثال مکمل خوراکی بایوترونیک تاپ3 یکی از مکمل های خوراکی موجود در بازار است که محصولی اسیدی‌ فایری و یک محصول تجاری است که برای کنترل باکتری‌های بیماری‌زا استفاده می‌شود و حاوی ترکیب نوآورانه‌ی بایومین پرمی ابلایزینگ و مخلوطی از اسیدهای آلی است(49). ترکیب بایومین پرمی ابلایزینگ می‌تواند غشای خارجی باکتری‌های گرم منفی را ضعیف کرده و حساسیت آن ها را به اثرات ضدمیکروبی سایر اجزای فعال خوراک افزایش دهد. اجزای تشکیل دهنده ترکیب تجاری اسیدهای آلی خوراکی بایوترونیک تاپ3 شامل: اسید فرمیک، اسیدپروپیونیک بوده که یک ترکیب ضد قارچ قوی است و اسیدیته محیط را کاهش می دهد(24) و هم چنین، نمک های آن ها شامل: آمونیوم فرمات و آمونیوم پروپیونات می باشند. ترکیبات شیمیایی گیاهی آن نیز شامل ترکیب طبیعی و زیست فعال گیاهی است که سبب مهار تقسیم سلولی و کاهش تکثیر باکتری­های مضر می شود. این ترکیب طبیعی سینامآلدئید نام دارد که از طریق اختلال در تشکیل ماده، تقسیم و تکثیر باکتری­ها را مهار می نماید. بر اساس تحقیقات انجام شده استفاده از بایوترونیک تاپ3 در جیره غذایی ماهی سبب مقاومت ماهی در برابر باکتری های اشریشیا کلی (E. coli) و سالمونلا(Salmonella) شده است. دو مکانیسم برای عمل ضدباکتریایی بایوترونیک تاپ3 پیشنهاد شده است؛ کاهش pH باعث توقف رشد باکتری ها می شود(59). هم چنین، اسیدهای آلی به صورت غیریونیزه از غشا باکتری عبور کرده و در داخل سیتوپلاسم به H+ و HCOO- تبدیل شده و در سنتز پروتئین دخالت می کنند. سینامالدهید نیز توانایی آنتی بیوتیکی داشته و تحقیقات نشان داد که استفاده از این ترکیب از لارو ماهی باربوت در برابر آلودگی با A. salmonicida و A. hydrophila حفاظت می کند(52). تحقیقات نشان داد که تاکنون مکمل اسیدی فایر بایوترونیک تاپ3 عملکردهای مثبتی در آبزیان داشت؛ برای مثال، ضاحی زاده و همکاران(1399)، در نتایج مطالعه ای جهت بررسی اثرات سطوح مختلف مکمل بایوترونیک تاپ 3 بر شاخص های رشد، تغذیه و ترکیبات بیوشیمیایی بدن میگوی پا سفید(Litopenaeus vannamei) به مدت 64 روز بیان کردند که افزودن 2 گرم در کیلوگرم مکمل بایوترونیک تاپ 3 سبب افزایش معنادار شاخص های رشد و بهبود ترکیبات بیوشیمیایی بدن میگوی پا سفید شد(10). هم­چنین، اصغرزاده و طاعتی(1399) و حسینی شکرابی و همکاران(1399) گزارش کردند که مکمل اسیدی فایر می­تواند باعث ارتقای عملکرد رشد و بهبود برخی از پارامترهای خونی و ایمنی ماهی کپور معمولی گردد(3،6). تاسماهی ایرانی(قره برون) با نام علمی Acipenser persicus گونه بومی دریای خزر بوده که از ارزش اقتصادی و شیلاتی مهمی بر خوردار می باشد(22). این ماهیان زمستان را در قسمت های میانی و جنوبی دریای خزر گذرانده و در این مناطق تغذیه می کنند و پراکندگی آن ها در نقاط مختلف خزر یکسان بوده و برای تخم­ریزی در صورت مناسب بودن شرایط به رودخانه هایی مانند: تجن، سفید رود و گرگان رود مهاجرت می کنند. امروزه تکثیر مصنوعی و رهاسازی بچه ماهیان این گونه در حوضه جنوبی دریای خزر از تلاش های عمده شرکت سهامی شیلات ایران می‏باشد. تاسماهی ایرانی یا همان قره برون دارای ارزش تجاری بسیار بالایی بوده هم چنین گوشت و خاویار آن دارای ارزش غذایی بالایی است. تغذیه و خوراک ماهیان خاویاری مانند سایر آبزیان از اصلی ترین عوامـل مـوثر در مـدیریت پرورش آبزیان می باشد؛ به طوری که بررسی وضعیت تغذیه ای و اقتصادی جیره غذایی به منظور افزایش بازده تولید و فراهم آوردن سود دهی بیشتر، ارزیابی و تعیین نیازهای غذایی ماهیان امری است که ضروری به نظر می رسد(67). بر اساس مطالعات انجام شده، کارایی تغذیه، درصد غذا دهی، درجه حرارت آب و اندازه ماهی از جمله عوامل اقتصادی هستند که قابلیت تولید تجاری ماهیان را تحت تاثیر قرار می دهد. از این رو، برای سودمندکردن پرورش تاسماهیان، نیاز به دقت در مراحل غذادهی و استفاده از مکمل های غذایی می­باشد(17). ماهیان خاویاری دارای بینایی بسیار ضعیفی می­باشند؛ ولی حس بویایی و چشایی آن ها به دلیل وجود گیرنده های شیمیایی به خوبی توسعه یافته و وجود آن ها برای رفتارهای تغذیه ای، تخم ریزی، مهاجرت و جهت­یابی بسیار ضروری است(69). علاوه بر این، افزودن مکمل­های غذایی در جیره می تواند سبب تحریک شاخص های رشد و سیستم ایمنی این ماهی گردد(40). بنابر این، به کار بردن مکمل غذایی مناسب که سبب جذب این ماهیان و ترغیب آن ها برای گرفتن غذای دستی باشند، حائز اهمیت می باشد. با توجه به توسعه گیرنده های شیمیایی برای تغذیه، این پرسش مطرح است که آیا یک مکمل غذایی شامل ترکیبی از اسیدهای آلی می تواند به عنوان محرک غذایی و جاذب ها عمل نمایند؟ تاکنون مطالعه ای در خصوص بررسی اثرات استفاده از مکمل غذایی بایوترونیک تاپ 3 در جیره غذایی تاسماهی ایرانی صورت نگرفته است؛ لذا تحقیق حاضر با هدف بررسی اثر افزودن بایوترونیک تاپ3 به جیره غذایی تاسماهی ایرانی بر شاخص های رشد، ایمنی موکوس و خون و بیان ژن­های مرتبط رشد( IGF،GH, Ghrelin) صورت گرفت.

مواد و روشها

طراحی آزمایش

 این آزمایش به مدت 8 هفته در سالن آبزی پروری شهید ناصر فضلی برآبادی دانشگاه علوم کشاورزی و منابع طبیعی گرگان انجام شد. تعداد 240 قطعه بچه ماهی قره­برون با میانگین وزنی و طولی 1 ± 104 گرم از کارگاه تکثیر و پرورش شهید رجائی واقع در شهرستان ساری تهیه شد. قبل از شروع آزمایش، ماهیان به مدت دو هفته جهت سازگاری با شرایط آزمایش نگهداری شدند. سپس، ماهی­ها تحت 3 تیمار آزمایشی شامل 2، 4 و 8 گرم بایوترونیک تاپ3 بر کیلوگرم جیره و یک گروه شاهد شامل جیره پایه و فاقد افزودنی(هر کدام با سه تکرار) در 12 مخزن فایبرگلاس با تراکم 20 قطعه در هر مخزن، به صورت تصادفی توزیع و با جیره های آزمایشی مورد تغذیه قرار گرفتند(5). در این آزمایش، غذای تجاری کارخانه بیومار فرانسه به عنوان جیره پایه در نظر گرفته شد که ترکیبات تقریبی آن در جدول 1 ذکر شده است. در طی دوره، غذادهی بچه ماهیان هر تیمار با جیره های غذایی آزمایشی به صورت دستی و بر اساس حداکثر 5% وزن توده زنده در 8 نوبت انجام گردید. در طی مدت آزمایش، تمامی شاخص های فیزیکوشیمیایی آب محیط پرورشی تاسماهی ایرانی در طول آزمایش در حد ثابت نگهداری شد(درجه حرارت 20-22 درجه سانتی گراد، پی اچ 5/7، سختی 421-423 قسمت در میلیون، اکسیژن 8 میلی گرم در لیتر) و آب در تمام مدت در حال چرخش بود و تعویض ورودی آب  با دبی1 لیتر در هر 4 ثانیه انجام می‌شد.

سنجش شاخص های رشد:

 زیست‌سنجی ماهیان در ابتدا و انتهای دوره انجام شد. بدین منظور 24 ساعت قبل از نمونه برداری، غذادهی متوقف شده و ماهیان پس از صید به صورت تصادفی، سریعاً با پودر گل میخک بیهوش می شدند. طول کل ماهیان با استفاده از خط کش با دقت 1 سانتی متر و وزن آن ها با استفاده از ترازو با دقت 1/0 گرم اندازه گیری شد. شاخص های رشد با استفاده از روابط زیر محاسبه گردید(66):

وزن اولیه-وزن نهایی = افزایش وزن بدن

100 ×[وزن اولیه / افزایش وزن] = درصد افزایش وزن

100 ×[طول دوره پرورش / (لگاریتم طبیعی وزن اولیه - لگاریتم طبیعی وزن نهایی)] = نرخ رشد

ویژه (درصد در روز)

افزایش وزن / مقدار غذای مصرفی] = ضریب تبدیل غذایی]

نمونه برداری از موکوس و بررسی برخی از شاخصهای ایمنی آن

 جمع آوری موکوس بر اساس روش Ross و همکاران(2000) انجام شد(63). برای این منظور، از هر تانک 3 عدد ماهی به صورت تصادفی جهت نمونه برداری صید و پس از بیهوشی با پودر گل میخک به میزان 5 میلی گرم بر لیتر، به صورت جداگانه درون کیسه های پلی اتیلنی(زیپ پلاست) حاوی 1 تا 2 میلی لیتر سدیم کلرید 50 میلی مولار قرار گرفت و پس از 2 دقیقه ماهی ها از کیسه ها خارج گردیدند. موکوس جمع آوری شده به مدت 10 دقیقه در دمای 4 درجه سانتی گراد سانتریفیوژ شد و سوپرناتانت به میکروتیوپ 5/1 میلی لیتری منتقل شد. سنجش آنزیم لیزوزیم به روش کدورت سنجی و با استفاده از دستگاه اسپکتروفتومتر انجام شد. برای سنجش این آنزیم از باکتری میکروکوکوس لوتئوس (Micrococcus luteus)(Sigma, USA) حساس به آنزیم لیزوزیم به عنوان سوبسترا استفاده گردید و کاهش کدورت آن طی 180 ثانیه در طول موج 504 نانومتر توسط دستگاه اسپکتروفتومتر قرائت می شد(71). جهت اندازه­گیری ایمونوگلوبین کل از روش Siwicki و Anderson(1993) استفاده شد(70). میزان پروتئین کل موکوس به روش بردفورد تعیین شده و سپس به نمونه پلی­اتیلن گلایکول 12 درصد اضافه شد. نمونه ها پس از گذشت 2 ساعت در دمای اتاق  سانتریفوژ شدند و غلظت پروتئین کل در قسمت بالایی محلول مجدداً اندازه گیری شد. سپس، میزان ایمونوگلوبین کل، از تفریق غلظت پروتئین در نمونه اولیه و غلظت پروتئین پس از افزودن پلی­اتیلن گلایکول محاسبه گردید. فعالیت آلکالین فسفاتاز طبق دستورالعمل موحود روی بسته کیت شرکت پارس آزمون(ساخت تهران - ایران) ارزیابی شد. نمونه ها در دمای 37 درجه سانتی گراد انکوبه شدند و جذب نوری در طول موج 405 نانومتر توسط دستگاه اسپکتروفتومتر قرائت گردید.

خون گیری و بررسی شاخص های ایمنی سرم

 در انتهای آزمایش و قبل از نمونه گیری ، تغذیه ماهیان به مدت 24 ساعت متوقف شد؛ سپس تعداد 5 قطعه ماهی(از ماهیانی که برای گرفتن موکوس صید شده بودند، استفاده نشد) به طور تصادفی از هر تیمار انتخاب و سریعاً با استفاده از 200 میلی گرم پودر گل میخک به ازای هر لیتر آب تازه و فاقد کلر، بیهوش شدند. خون گیری از ساقه دمی ماهیان انجام شد. نمونه های خونی جمع آوری و در تیوب های ضدانعقاد خون نگه داری شدند. سپس، در دمای 4 درجه سانتی گراد به مدت 15 دقیقه با دور 3000 دور در دقیقه، سانتریفیوژ گردیدند. سوپرناتات(مایع روی تیوب ها) جدا گردید و به تیوب های جدید منتقل شد. سنجش گلوکوز با روش آنزیمی گلوکوز-هگزوکیناز ساخت شرکت Sigma Aldrich آلمان با استفاده از روش Falahatkar و همکاران(2009) از طریق اسپکتروفتومتری بر حسب میلی گرم در دسی لیتر انجام شد(29). پروتئین کل سرم با استفاده از روش Bradford و همکاران(1976) ارزیابی گردید؛ بدین منظور از آلبومین سرم گاوی به عنوان استاندارد استفاده شد و میزان جذب نوری نمونه ها با استفاده از دستگاه اسپکتروفتومتر در طول موج 595 نانومتر قرائت شد(23). هم چنین، میزان فعالیت آلکالین فسفاتاز سرم نیز طبق دستورالعمل موحود روی بسته کیت شرکت پارس آزمون(ساخت تهران - ایران) در طول موج 405 نانومتر توسط دستگاه اسپکتروفتومتر قرائت گردید. جهت سنجش آنزیم های کبدی، از کیت های آنزیمی شرکت پارس آزمون ساخت ایران و بر دستورالعمل پیشنهادی شرکت سازنده استفاده شد. برای این منظور، برای سنجش آنزیمALT وAST از روش IFCC(فدراسیون بین المللی شیمی بالینی و طب آزمایشگاهی) استفاده گردید. سپس، جذب نوری نمونه­ها در طول موج 340 نانومتر با استفاده از دستگاه اسپکتروفتومتر قرائت شد(2).

سنجش بیان ژن های مرتبط با رشد

 پس از 8 هفته تغذیه با جیره های آزمایشی، از روده و مغز 3 قطعه ماهی به طور تصادفی برای سنجش بیان ژن­های مربوط با رشد و اشتها( IGF،Ghrelin، GH) نمونه برداری انجام شد. نمونه بافت های به دست آمده پس از قرارگیری در تیوب های استریل، سریعاً به تانک ازت مایع منتقل و تا زمان استخراج RNA در فریزر با دمای 80- درجه سانتی­گراد نگهداری شدند. استخراج RNA بر اساس روش Awad و همکاران(2011) توسط ماده هضم‌کننده RNAx-Plus و طبق دستورالعمل پیشنهادیه شرکت سازنده انجام شد(19). ارزیابی کیفی RNAکل توسط دستگاه الکتروفورز و ژل آگارز 1% در دستگاه مستند‌ساز ژل(UviTec Cambridg, CB4 IQB, UK) به وسیله پرتو فرا‌بنفش انجام شد و کمیت (غلظت) RNA با استفاده از دستگاه نانودراپ (Pico200, Picodrop Co. UK / ساخت آمریکا) در طول موج‌های 280،260،230 و320 نانومتر تعیین گردید. برای حذف DNA، از دستورالعمل به کارگیری آنزیم هضم کننده DNA استفاده شد. بدین منظور، از کیت شرکت فرمنتاز محصول کشور آمریکا استفاده شد. برای سنتز cDNA از مسترمیکس سنتز cDNA شرکت جینت بایو ساخت کشور کره و طبق دستورالعمل پیشنهادیه شرکت سازنده انجام شد(50). آغازگرهای مورد استفاده در این آزمایش از مطالعات قبلی گرفته شده و با نرم افزار بایو ادیت با استفاده از توالی­های موجود در بانک ژن مورد آزمون قرار گرفتند(جدول 2) و با آزمایش کردن در دستگاه PCR بهترین دما برای تکثیر به دست آمد. Real time PCR در تیوپ های مخصوص آن و در 3 تکرار برای هر تیمار انجام شد؛ محتویات هر تیوپ به مقدار 20 میکرولیتر به صورت 10 میکرولیتر بافرسایبرگرین، 1 میکرولیتر آغازگر پیش رونده ژن هدف و رفرنس، 1 میکرولیتر آغازگر پس رونده ژن هدف و رفرنس، 8/2 میکرولیتر آب تزریق، 2/0 آنزیم تگ پلیمراز و 5 میکرولیتر cDNA رقیق شده بود(50).

تجزیه و تحلیل آماری داده ها

برای تجزیه و تحلیل آماری داده ها از نرم افزار آماری SPSS نسخه 23 استفاده شد. تجزیه و تحلیل آماری داده­ها با استفاده از آنالیز واریانس یک طرفه صورت پذیرفت. نرمال بودن داده ها و همگنی واریانس ها به ترتیب با استفاده از آزمون های کولموگروف-اسمیرنوف و بارتلت بررسی و در تمام بررسی ها سطح معنی دار بودن اختلاف­ها کمتر از 05/0 در نظر گرفته شد. نتایج به صورت انحراف از معیار± میانگین گزارش گردید. هم چنین، داده‌های به دست آمده جهت تعیین بیان نسبی ژن های مربوطه در مقایسه با ژن رفرنس با روش Ct∆∆-2 با کمک نرم‌افزار Excel(2010) مورد آنالیز قرار گرفت(56).

 

 

جدول 1- ترکیب تقریبی جیره غذایی پایه (بیومار/ فرانسه) جهت تغذیه تاسماهی ایرانی

ترکیب تقریبی جیره

پروتئین خام (%)

54

کربوهیدرات (%)

5/13

چربی خام (%)

17

خاکستر (%)

4/10

فیبر خام (%)

2/1

فسفر کل (%)

42/1

پروتئین قابل هضم (%)

9/24

انرژی قابل هضم (کیلوکالری)

3/19

انرژی خالص (کیلوکالری)

2/22

کلسیم (%)

33/2

سدیم (%)

66/0

آنتی اکسیدان (میلی­گرم در کیلوگرم)

53

جدول 2- مشخصات آغازگر های مورد استفاده در بیان ژن های هدف و رفرنس در تاسماهیان تغذیه شده با جیره غذایی حاوی بایوترونیک تاپ3 به مدت 8 هفته.

ژن       

توالی پرایمر

GH

رفت: GATCAGACGTGGAGCTGCTT

برگشت: GATCCCTCATGAGAGCCACA

IGF-1

رفت: CAGTTTGTGTGTGGGGAGAG

برگشت: GGCACGTACAGAGCGTGAG

Ghrelin

رفت: AAGATGACACGTCGAGATTCAGAA

برگشت: GACCATCTTGTATTGAAAGCATCC

Beta actin

رفت: GGACTCCACTGAGCCCACCT

برگشت: GGGTTGTAGCCGATCTTCTTG

 

نتایج

شاخص های رشد

 بر اساس نتایج مشخص گردید که بیشترین میزان وزن و طول نهایی، درصد افزایش وزن، نرخ رشد ویژه و کم­ترین میزان ضریب تبدیل غذایی در گروه شاهد وجود داشت که در مقایسه با تمامی تیمارها دارای اختلاف معنادار بود(05/0 >P). با این حال، در میزان بازماندگی بین گروه شاهد و تیمارها هیچ اختلاف معناداری مشاهده نشد(05/0 <P)(جدول 3).

 شاخص های ایمنی موکوس

 بر اساس نتایج حاصل از جدول4 مشخص گردید که بیشترین میزان فعالیت آلکالین فسفاتاز و پروتئین کل در تیمار تغذیه شده با جیره حاوی 8 گرم بایوترونیک تاپ3 در کیلوگرم جیره وجود داشت که با گروه شاهد و سایر تیمارها دارای تفاوت معنادار بود(05/0 >P). تجویز بایوترونیک تاپ3 در جیره غذایی تاسماهی ایرانی، فعالیت آنزیم لیزوزیم را به طور قابل توجهی افزایش داد که با گروه شاهد اختلاف معنادار داشت(05/0 >P).

شاخص های ایمنی سرم

 با توجه به جدول 5، میزان گلوکوز خون در تیمار تغذیه شده با جیره های حاوی بایوترونیک تاپ3 با گروه شاهد دارای تفاوت معنادار نبود(05/0 <P). بیشترین میزان پروتئین کل در تیمارهای تغذیه شده با جیره حاوی 8 گرم بایوترونیک تاپ3 مشاهده شد که با گروه شاهد دارای تفاوت معنادار بود(05/0 >P). میزان آسپارتات ترانس آمیناز سرم خون در تمامی تیمارهای تغذیه شده با جیره حاوی بایوترونیک تاپ3 در مقایسه با گروه شاهد به طور معناداری کاهش یافت(05/0 >P). بیشترین میزان آلانین ترانس آمیناز نیز، در گروه شاهد مشاهده شد که با تیمار تغذیه شده با جیره حاوی 8 گرم بایوترونیک تاپ3 به ازای کیلوگرم غذا دارای تفاوت معنادار بود(05/0 >P). در میزان آلکالین فسفاتاز سرم خون در تمامی تیمارهای تغذیه شده با جیره حاوی بایوترونیک تاپ3 و گزوه شاهد اختلاف معناداری مشاهده نشد(05/0 <P).

بیان ژن های مرتبط با رشد

 باتوجه به جدول6 مشاهده گردید که بیشترین میزان بیان ژن GH در گروه شاهد وجود داشت که در مقایسه با سایر تیمارها اختلاف معنادار داشت(05/0>P)؛ هم چنین روند مشابهی در ارتباط با بیان ژن گرلین و هورمون شبه انسولین نیز مشاهده شد؛ بدین معنا که بیشترین میزان بیان این دو ژن نیز در گروه شاهد ثبت شد که در مقایسه با تیمارهای آزمایشی دارای اختلاف معنادار بود(05/0>P).

 

 

جدول3-برخی از شاخص های رشد در تاسماهی ایرانی تغذیه شده با سطوح مختلف بایوترونیک تاپ 3  در جیره غذایی به مدت 8 هفته.

شاخص های رشد

سطوح متفاوت بایوترونیک تاپ3 (گرم بر کیلوگرم غذا)

0 (شاهد)

2

4

8

وزن اولیه (­گرم)

a76/0 ± 45/103

a41/0 ± 54/104

a17/0 ± 75/104

a17/0 ± 66/104

وزن نهایی (­گرم)

a15/0 ± 38/257

d61/1 ± 72/157

c05/2 ± 63/206

b21/3 ± 00/233

طول اولیه (سانتی­متر)

a04/1 ± 95/33

a88/0 ± 84 /33

a67/0 ± 47/34

a42/0 ± 83/34

طول نهایی (سانتی­متر)

b 32/0 ± 40/39

b53/0 ± 10/37

b33/0 ± 33/37

ab58/0 ± 00/38

درصد افزایش وزن بدن (درصد)

a96/1 ± 82/148

d97/0 ± 86/50

c67/1 ± 26/97

b87/2 ± 61/122

نرخ رشد ویژه (درصد وزنی/ روز)

a01/0 ± 76/0

d01/0 ± 34/0

c01/0 ± 57/0

b01/0 ± 67/0

ضریب تبدیل غذایی

d02/0 ± 68/4

a11/0 ± 31/8

b05/0 ± 68/5

c09/0 ± 08/5

درصد بازماندگی (%)

a 0/0 ± 0/100

a 0/0 ± 0/100

a 0/0 ± 0/100

a 0/0 ± 0/100

*اعداد (میانگین±خطای استاندارد) در یک ردیف با حروف متفاوت، نشان دهنده وجود اختلاف‌ معنی‌دار بین تیمار‌های آزمایشی است (05/0>P).

 

 

 

 

 

جدول4- برخی از شاخص­های ایمنی موکوس در تاسماهی ایرانی(قره برون) تغذیه شده با سطوح مختلف بایوترونیک تاپ3 در جیره غذایی به مدت 8 هفته.

سطوح مختلف بایوترونیک تاپ3 (گرم بر کیلوگرم جیره)

شاخص­های ایمنی موکوس

8

4

2

0 (گروه شاهد)

 

a51/2±40/58

b04/3±85/26

c13/3±20/13

c11/1±75/13

آلکالین فسفاتاز (واحد بین المللی در لیتر)

a68/1±91/9

b58/2±77/7

c18/0±01/6

c24/0±13/6

پروتئین کل  (گرم در دسی­لیتر)

a25/0±96/5

a31/0±12/5

a83/0±05/5

b11/0±69/3

لیزوزیم (تراکم نوری در دقیقه)

a21/3±71/64

b11/3±53/58

c16/2±08/52

c32/2±00/51

ایمنوگلوبولین  (میلی­گرم در دسی­لیتر)

           

* حروف مشابه در هر ردیف، نشان­دهنده عدم وجود معناداری بین تیمارهای مختلف می­باشد (05/0 >P).

جدول5- برخی از شاخص­های بیوشیمیایی سرم خون تاسماهی ایرانی(قره برون) تغذیه شده با سطوح مختلف بایوترونیک تاپ3 در جیره غذایی به مدت 8 هفته.

سطوح مختلف بایوترونیک تاپ3 (گرم بر کیلوگرم جیره)

شاخص­های بیوشیمیایی سرم

8

4

2

0 (گروه شاهد)

a77/1±59/85

a40/7±27/75

a21/3±06/77

a89/2±08/83

گلوکز (میلی­گرم در دسی­لیتر)

a14/0±92/4

b20/0±58/2

c03/0±44/1

c04/0±25/1

پروتئین کل  (گرم در دسی­لیتر)

b87/0±83/12

b84/0±71/13

b01/1±50/17

a76/1±33/33

آسپارتات ترانس آمیناز (واحد بین المللی در لیتر)

b34/1±41/6

a84/0±12/13

a18/0±37/11

a85/1±71/13

آلانین ترانس آمیناز (واحد بین المللی در لیتر)

a26/8±30/344

a17/3±80/382

a06/1±60/314

a79/10±40/433

آلکالین فسفاتاز (واحدبین المللی در لیتر)

* حروف مشابه در هر ردیف، نشان­دهنده عدم وجود معناداری بین تیمارهای مختلف می­باشد (05/0 >P).

 

جدول 6- بیان نسبی ژن  GH, IGF-1 و Ghrelin  در تاسماهی ایرانی تغذیه شده با جیره­ حاوی سطوح متفاوت بایوترونیک تاپ3 به مذت 8 هفته.

سطوح مختلف بایوترونیک تاپ3 (گرم بر کیلوگرم جیره)

بیان نسبی ژن­های دخیل در رشد و اشتها

8

4

2

0 (گروه شاهد)

b02/0±65/0

b09/0±34/0

b02/0±24/0

a03/0±00/1

GH

b05/0±41/0

b09/0±19/0

b06/0±15/0

a09/0±01/1

Ghrelin

b05/0±49/0

b09/0±30/0

b02/0±19/0

a06/0±01/1

IGF-1

*حروف متفاوت در هر ردیف نشان دهنده وجود معناداری می­باشد (05/0>P).

شکل 1- تعیین کیفیت RNA استخراج شده بر روی ژل آگارز.

 

بحث و نتیجه گیری

یکی از اهداف آبزی پروری، کاهش ضریب تبدیل غذایی و استفاده از غذاهایی با کیفیت بالا و قیمت مناسب است، همچنین، استفاده از محرک های رشد از قبیل اسیدهای آلی  در چند سال اخیر به طور چشمگیری در حال افزایش است(12). اسیدهای آلی بر طبق قوانین اتحادیه اروپا جزء افزودنی های مجاز غذایی در خوراک دام و آبزیان می باشند که هیچ گونه بقایای مضر و نامناسبی در گوشت باقی نمی گذارند؛ لذا، استفاده از اسیدهای آلی و نمک های آن ها در خوراک تمامی دام ها و آبزیان مجاز می باشد(43، 42). همان طور که در نحقیق حاضر مشاهده شد بهترین عملکرد شاخص های رشد در گروه شاهد مشاهده شد؛ پس از آن تیمار تغذیه شده با جیره حاوی بایوترونیک تاپ3 در مقایسه با سایر تیمارها دارای عملکرد بهتری بود که البته هر سه تیمار در مقایسه با گروه شاهد به طور معناداری دارای میزان رشد پایین تری بودند که این امر نشان می دهد که بایوترونیک تاپ3 نه تنها نتوانست اثر مثبتی روی رشد تاسماهیان ایرانی داشته باشد؛ بلکه، با اعمال اثر منفی روی رشد، میزان رشد را در مقایسه با گروه شاهد نیز کاهش داد. این نتایج در تضاد با نتایج حاصل از تحقیقات حسینی شکرابی و همکاران(1399) می باشد(6). آن ها پس از بررسی اثر افزودن بایوترونیک تاپ3 در جیره غذایی ماهی کپور معمولی بر عملکرد رشد بیان کردند که استفاده از این محرک به میزان 3 درصد جیره به طور معناداری بهترین عملکرد رشد را در مقایسه با گروه شاهد داشت. هم چنین، Ringo و Strum(1994)، بیان کردند که جیره های حاوی اسید لاکتیک و اسید پروپیونیک سبب افزایش وزن در ماهی چار(Salvelinus alpinus) شد(60) که با نتایج حاصل از این تحقیق مطابقت نداشت. به طورکلی ممکن است در بسیاری از موارد در ارتباط با استفاده از اسیدهای آلی و نمک های آن ها اثراتی متفاوت تر از آن چه که در سایر گونه های تغذیه شده با آن ها مشاهده می شود، رخ دهد. برای مثال در ارتباط با تحقیق حاضر که کاهش رشد تاسماهیان ایرانی پس از تغذیه با رژیم غذایی حاوی بایوترونیک تاپ3(به عنوان یک کمپلکس از اسیدهای آلی و نمک­های آن ها) مشاهده شد، می توان چنین احتمال داد که در این شرایط، کاهش رشد به دلیل عدم تمایل ماهیان تغذیه شده با سطوح متفاوت اسیدهای آلی و نمک های آن ها به غذاگیری باشد. به علاوه، از آن جایی که تاسماهی ایرانی جزو ماهیانی است که تمایلی به تغذیه با جیره دستی ندارد و ترغیب آن برای گرفتن غذای دستی بسیار سخت می­باشد؛ ممکن است جیره های حاوی بایوترونیک تاپ3 نه تنها هیچ جذابیتی برای آن ها نداشت؛ بلکه، باعث پس زدن غذا و نخوردن آن(به میزانی نبود که سبب رشد شود) شد؛ چرا که در ماهیان خاویاری در وهله اول جذابیت غذا از اهمیت ویژه ای برخوردار است و ماهی پس از ارزیابی غذا برای بلع یا پس زدن آن تصمیم می گیرد(9). لذا، این اثرات منفی در رشد ممکن است به همین دلیل باشد که البته نتایج حاصل از بیان ژن رشد و اشتها نیز می تواند سند خوبی برای تایید این تحلیل باشد. زیرا همان طور که مشاهده گردید میزان بیان ژن مربوط به هورمون رشد و اشتها(GH, IGF-1, Ghrelin) در گروه های تیمار در مقایسه با گروه شاهد به طور معناداری کاهش یافت. در بین افزودنی ها، اسیدی فایرها یا مکمل های اسیدهای آلی و نمک های شان به عنوان جایگزین مناسبی برای آنتی­بیوتیک ها برای افزایش ایمنی بدن آبزیان معرفی شده اند(13). در تحقیق حاضر، استفاده از 8 گرم بایوترونیک تاپ 3 در کیلوگرم غذای تاسماهی ایرانی به طور معناداری سبب افزایش برخی از شاخص های ایمنی موکوس شامل آلکالین فسفاتاز، پروتئین کل، لیزوزیم و ایمنوگلوبین در مقایسه با گروه شاهد شد. لیزوزیم آنزیم هضم کننده موکوس با منشا لکوسیتی با خاصیت دفاعی در برابر تهاجم میکروب‌ها می باشد. این آنزیم به صورت گسترده ای در طبیعت و ترشحات موکوس، بزاق و هم چنین در بسیاری از بافت‌ها نظیر خون و واکوئل‌های سلول‌های گیاهی یافت می‌شود(11). لیزوزیم با شکست پیوند بتا 1 به 4 بین استیل مورامیک اسید و ان-استیل گلوکوزامین موجود در دیواره سلولی(لایه پپتیدوگلیکان) باکتری‌های گرم مثبت از تهاجم آن ها جلوگیری کرده و به عنوان یک اپسونین فعالیت مسیر فرعی کمپلمان و بیگانه خوار‌ها را برای از بین بردن باکتری‌های گرم منفی فعال می کند(68). آلکالین فسفاتاز موجود در موکوس نیز، نقش موثری در مقابله با عوامل استرس زا داشته و بهبود ایمنی را به عنوان اولین پاسخ ایمنی سبب می گردد؛ غلظت پروتئین کل موکوس معمولاً به عنوان یک شاخص بالینی مهم سلامتی و تنش موجود و ارزیابی شرایط تغذیه‌ای آن ها در نظر گرفته می‌شود(16). ایمونوگلوبین ها جزءآنتی بادی های طبیعی بوده و به صورت کاملاً تنظیم شده ای در غیاب محرک آنتی­ژنیک خارجی تولید می گردند و بدین طریق محافظت سریع و گسترده ای را در برابر عوامل بیماری زا ایجاد می کنند. به همین دلیل به عنوان یکی از بخش های حیاتی سیستم ایمنی ذاتی ماهیان در نظر گرفته می شوند(53). بنابراین، فعالیت این شاخص ها به عنوان یک شاخص بالقوه استرس در موکوس ماهیان تلقی می گردد(16). با وجود مطالعات گسترده، هنوز اطلاعات محدودی در ارتباط با اثرات اسیدهای آلی یا نمک هایشان روی پاسخ ایمنی موکوس ماهیان موجود است(41،54). با این حال، نتایجی که تاکنون به دست آمده، بسیار امیدوارکننده می باشد. همسو با نتایج این تحقیق می توان به بررسی های انجام شده در ارتباط با افزایش پاسخ ایمنی موکوس پس از افزودن اسیدهای آلی در جیره ماهی زبرا(36)، ماهی سفید دریای خزر(37) و تیلاپیای نیل(58) اشاره کرد که سبب افزایش معنادار سطح ایمنوگلوبین و فعالیت لیزوزیم در مقایسه با گروه شاهد شد. میزان ایمنوگلوبین ماهی تحت تاثیر اندازه، شرایط محیطی و وضعیت سلامتی ماهی می باشد(44،45) احمدنیا و همکاران(2020)، پس از افزودن سرکه سیب(شامل ترکیبی از اسید آلی) به جیره ماهی گرین ترور و بررسی شاخص های ایمنی موکوس بیان کرد که میزان آلکالین فسفاتاز، فعالیت لیزوزیم، ایمنوگلوبین و پروتئین کل در گروه های تیمار در مقایسه با گروه شاهد بالاتر بود(18). سرکه سیب حاوی ترکیبلت پلی فنول و اسیدهای آلی مانند: اسیداستیک، اسید سیتریک، اسید فرمیک، لاکتیک اسید، اسید مالیک و سوکسنیک اسید است(51)؛ این مواد به دلیل ماهیت اسیدآلی بودنشان با تنظیم پاسخ ایمنی ذاتی از طریق اتصال به گیرنده همراه پروتئین G(که به طور عمده در سلول های التهابی بیان می شود) دارای اثرات تعدیل کنندگی سیستم ایمنی می باشند(57،65، 47). از آن جایی که اطلاعات کافی در ارتباط با اثرات بایوترونیک تاپ 3 روی ایمنی موکوس تاسماهی ایرانی و یا گونه دیگری وجود ندارد؛ می توان به مطالعات مشابه در ارتباط با افزایش شاخص های مذکور در سرم سایر گونه ها اشاره کرد؛ برای مثال، در تطابق با نتایج حاصل از تحقیق حاضر، اصغرزاده و طاعتی(1399)، بیان کردند که افزودن بایوترونیک تاپ 3 به جیره غذایی ماهی کپور معمولی سب افزایش میزان لیزوزیم و ایمنوگلوبین سرم در مقایسه با گروه شاهد شد(3). هم چنین، حدیدی و طاعتی(1395)، گزارش کردند که استفاده از بایوترونیک در جیره ماهی اسکار سبب افزایش لیزوزیم و ایمنوگلوبین سرم در گروه­های تیمار در مقایسه با گروه شاهد شد؛ اگرچه این افزایش معنادار نبود(5). هرگونه تغییر در سطح ایمنوگلوبین، پروتئین کل پلاسما، آنزیم های کبدی و گلوکز در سرم خون می تواند به عنوان یک شاخص بالینی در پایش سلامت سیستم ایمنی،کبد وکلیه مورد استفاده قرار گیرد(39، 8). بررسی این شاخص ها نه تنها برای بررسی وضعیت سلامت ماهی، بلکه برای بررسی احتمالی برخی از مواد ضد تغذیه ای حائز اهمیت می باشد. در تحقیق حاضر اختلاف معناداری در میزان گلوکز خون گروه های تیمار  و گروه شاهد مشاهده نشد. گلوکز یکی از فاکتورهای بیوشیمیایی خون می باشد که به عنوان یکی از شاخص های مهم در تعیین وضعیت فیزیولوژیک ماهی مطرح است. افزایش در مصرف گلوکز و متابولیت های دیگر در برخی از گونه ها، سبب کاهش ذخایر گلیکوژن و چربی ها شده و پروتئین ها در مرحله بعدی برای تامین انرژی شکسته می شوند(38). عدم وجود تغییر در سطح گلوکز خون ماهیان، نشان دهنده عدم تاثیر ترکیبات موجود در جیره و مکمل های غذایی بر مکانیسم های کنترل کننده جذب، ذخیره و متابولیسم گلوکز خون است. بنابراین، عدم وجود اختلاف معنادار بین گروه های تیمار و شاهد در تاسماهی ایرانی تغذیه شده  با جیره مکمل­سازی شده با بایوترونیک تاپ3 نشان دهنده عدم ایجاد اثرات مضر این ترکیب روی ایمنی و ایجاد استرس می­باشد. در توافق با نتیجه مطالعه حاضر، Robles و همکاران(2013)، گزارش کردند که استفاده از اسیدآلی بوتیرات به میزان 3 گرم در کیلوگرم غذا سبب کاهش میزان گیلیکولیز در ماهی طلایی شد. اطلاعات بسیار محدودی در ارتباط با اسیدهای آلی و نمک های آن ها روی تغییرات گلوکزماهیان وجود دارد(62). Adil و همکاران(2010)، بیان کردند که استفاده از اسیدهای آلی بوتریک اسید، فرمیک اسید و لاکتیک اسید سبب ایجاد اختلاف معنادار در میزان گلوکز گروه های تیمار و شاهد در جوجه های گوشتی نشد(15) که با نتایج حاصل از تحقیق حاضر مطابقت دارد. در تحقیق حاضر، بیشترین میزان پروتئین کل پلاسما در تیمار تغذیه شده با جیره حاوی 8 گرم بایوترونیک تاپ3 مشاهده شد که به طور معناداری با گروه شاهد اختلاف داشت؛ افزایش سطح پروتئین کل سرم می تواند در نتیجه افزایش چشمگیر سطوح فعالیت ضدپروتئازی علیه عوامل احتمالی بیماری زا باشد(30،31). در واقع ممکن است بایوترونیک تاپ3 نوعی محرک تلقی شده باشد که زمانی که با غلظت مناسب تجویز شد؛ القای ایمنی را سبب شد، حضور عوامل ممانعت کننده پروتئاز در سرم خون، به عنوان داشتن نقش اولیه در حفظ هموستازی مایعات بدن شناخته می شود(33،34). به طور کلی، عوامل ضد پروتئاز با ترشح آنزیم های پروتئولیتیک نقش دفاعی در برابر عوامل بیماری زا ایفا می کنند و سبب افزایش میزان پروتئین کل می­شوند(26). بر اساس تحقیقات نکوبین و همکاران(1399)، پروتئین کل سرم خون در ماهی کپور معمولی تغذیه شده با میزان 1 و 2 درصد سرکه سیب به طور معناداری در مقایسه با گروه شاهد افزایش یافت(14). پروتئین های پلاسما به وسیلۀ کبد سنتز و در بسیاری از بیماری ها و اختلالات فیزیولوژیک از بدن دفع می شوند. در واقع، کاهش میزان پروتئین کل پلاسما تحت شرایط استرس و یا شرایط نامناسب تغذیه ای در نتیجه اکسیداسیون اسیدهای آمینه و یا پروتئولیز محیطی روی می دهد(25). از سوی دیگر، افزایش میزان پروتئین کل سرم با تقویت پاسخ ایمنی غیراختصاصی ماهی مرتبط است؛ زیرا پروتئین های سرمی اجزای مختلف سیستم ایمنی غیراختصاصی را شامل می شوند(4). Baruah و همکاران(2007) گزارش کردند که تغذیه ماهی روهو با جیره مکمل سازی شده با اسیدسیتریک سبب افزایش میزان پزوتئین کل سرم خون شد(20،21) که با نتایج حاصل از تحقیق حاضر مطابقت داشت. آنزیم های کبدی آلانین ترانس آمیناز و آسپارتات ترانس آمیناز از فاکتورهای شیمیایی مهمی می باشند که سنجش آن ها به عنوان یک شاخص آزمایشگاهی استاندارد به کار می­رود. سنجش این دو آنزیم برای بررسی اختلالات کبدی در موجودات حائز اهمیت می باشد(55). این دو آنزیم کبدی، هنگام ایجاد عارضه، از بافت های مختلف مانند: عضلات، استخوان و قلب خارج می گردند. به عبارت دیگر، افزایش معنادار این دو آنزیم ممکن است در نتیجه آسیب های بافتی و نشت از بافت های مختلف آسیب دیده و تجمع آن ها در پلاسمای خون باشد. آنزیم آلانین ترانس آمیناز بیشتر در سیتوپلاسم سلول های کبدی بوده و هنگام آسیب، با عبور از غشای سلولی وارد جریان خون می­شوند. آلکالین فسفاتاز نیز آنزیمی است که در اپی تلیوم مجاری صفراوی، سلول­های کبدی و هم چنین در مخاط پوست و روده و کلیه ها یافت می شود(27). آلکالین فسفاتاز نقش به سزایی در مقابله با عوامل استرس زا و بهبود ایمنی به عنوان اولین پاسخ ایمنی ایفا می نماید. به طور کلی، افزایش این آنزیم ها در سرم خون به عنوان شناساگر اختصاصی آسیب های کبدی شناخته می شود(72). در تحقیق حاضر مشاهده شد که میزان آنزیم آسپارتات ترانس آمیناز در گروه های تغذیه شده با جیره حاوی بایوترونیک تاپ3 به طور معناداری کمتر از گروه شاهد بود. هم چنین میزان آنزیم آلانین ترانس آمیناز در تیمار تغذیه شده با جیره حاوی 8 گرم بایوترونیک تاپ3 به ازای کیلوگرم غذا کمتر از گروه شاهد بود. اگرچه بین گروه شاهد و سایر تیمارها این اختلاف معنادار نبود. بنابراین، به نظر می رسد عدم افزایش این آنزیم ها در تحقیق حاضر می تواند به این معنی باشد که بایوترونیک تاپ3 به عنوان ماده افزودنی به بافت کبد آسیبی وارد نکرده است. در تطابق با نتایج تحقیق حاضر، Hassaan و همکاران(2014)، بیان کردند که استفاده از نمک اسیدآلی در جیره ماهی تیلاپیای نیل سبب کاهش معنادار آنزیم­های کبدی آسپارتات ترانس آمیناز و آلانین ترانس آمیناز و افزایش میزان پروتئین کل سرم در مقایسه با گروه شاهد شد(32). Zhang و همکاران(2020)، گزارش کردند که میزان آسپارتات ترانس آمیناز و آلانین ترانس آمیناز سرم خون ماهی کاراس پس از استفاده از اسیدمالیک به میزان 2 درصد جیره و هم چنین ترکیبی از اسیدمالیک به میزان 2 درصد و اسیدسیتریک به میزان 1 درصد جیره تفاوت معناداری با گروه شاهد نداشت(73) که با نتایج تحقیق حاضر هم خوانی داشت؛ اگرچه استفاده ترکیبی از این دو اسیدآلی در غلظت بالاتر سبب ایجاد عوارض کبدی و افزایش معنادار این آنزیم ها شد. El-Sayed و همکاران(2018) میزان فعالیت آسپارتات ترانس آمیناز و آلانین ترانس آمیناز سرم خون ماهی تیلاپیای نیل تحت تاثیر جیره های حاوی بایوژن و سدیم بوتیرات قرار نگرفتند و تفاوتی با گروه شاهد نداشتند(28) که مطابق با نتایج تحقیق حاضر می باشد. در تحقیق حاضر، تفاوت معناداری در میزان آلکالین فسفاتاز سرم گروه های تیمار و گروه شاهد مشاهده نشد. در تطابق با نتایج حاصل از تحقیق حاضر، نکوبین و همکاران(1399)، بیان کردند که میزان آلکالین فسفاتاز سرم خون بچه ماهیان کپور معمولی پس از تغذیه با سطوح متفاوت سرکه سیب تفاوت معناداری با گروه شاهد نداشت(14). به طورکلی، افزودن بایوترونیک تاپ3 که ترکیبی از انواع اسیدهای آلی است، به جیره غذایی تاسماهی ایرانی ممکن است باعث ثبات غشای سلولی شده و از سلول های کبد محافظت کرده باشد. به عبارت دیگر، بایوترونیک تاپ3 به عنوان یک افزودنی توانست به کبد کمک کند تا کبد بتواند عملکرد طبیعی خودش را انجام دهد که این امر در ثبات و عدم تغییر میزان آلکالین فسفاتاز سرم نیز منعکس شده است(1،14). طبق نتایج حاصل از تحقیق حاضر مشاهده گردید که، رژیم غذایی حاوی 8 گرم بایوترونیک تاپ3 در کیلوگرم غذا باعث بهبود بیشتر ایمنی سرم خون و موکوس پوست شد؛ با این وجود، تمام سطوح بایوترونیک تاپ3 دارای اثرات منفی روی رشد تاسماهیان ایرانی بود. بنابراین، می توان بیان کرد که بایوترونیک تاپ3 تنها به عنوان یک محرک ایمنی در ارتقای سیستم ایمنی غیر اختصاصی تاسماهیان ایرانی جهت ارتقای ایمنی این گونه اقتصادی و با ارزش در کارگاه های تکثیر و پرورش ماهیان خاویاری ممکن است به کار برده شود. اگرچه، اظهار نظر دقیق در این باره نیازمند مطالعات بیشتر می باشد.

 

منابع
1-ابراهیم نژاد، ی.، شیوآزاد، م.، ناظرعدل، ک.، مرادیشهر بابک، م. 1385. اسیدسیتریک و آنزیم فیتاز میکروبی بر عملکرد و میزان استفاده از فسفر فیتاته در جوجه های گوشتی تغذیه شده با جیره ذرت کنجاله سویا. مجله تحقیقات دامپزشکی دانشگاه تهران. دوره 64. شماره 4. صفحه 407-413.
2-احمدپور م.، امانی ر.، حیدری ب. 1398. تغییرات شاخص­های متابولیسمی بچه ماهی سفید دریای خزر(Rutilus kutum) در مواجهه حاد و نیمه مزمن با ترکیبات نانوذرات اکسید مس و نانوکلوئید نقره. مجله علمی پژوهشی زیست‌شناسی جانوری تجربی. دوره 8. شماره 30. صفحه 51-67.
3-اصغرزاده، ص.، طاعتی، ر. 1399.  ارزیابی عملکرد رشد، برخی از پارامترهای خونی و ایمنی بچه ماهی کپورمعمولی تغذیه شده با مکمل اسیدی فایر. فصلنامه علمی پژوهشی محیط زیست جانوری. دوره 12. شماره 1.  صفحه 269-276.
4-اکرمی، ر.، ابرهیمی، ر.، شاملوفر، م.، رزاقی منصور، م. 1393. تاثیر پروبیوتیک مانان الیگوساکارید بر عملکرد رشد، بازماندگی و مقاومت لارو ماهی قرل آلای رنگین کمان، نشریه پژوهش های ماهی شناسی کاربردی. دوره 2. شماره 3. صفحه 29-42.
5-حدیدی، س.، طاعتی، ر. 1395. تأثیر سطوح مختلف مکمل اسیدی فایر بر کارایی تغذیه و برخی از پارامترهای خونی و ایمنی ماهی اسکار تایگر(Astronotus ocellatus). مجله دامپزشکی ایران،. دوره 12. شماره 3. صفحه 32-41.
6-حسینی شکرابی، س. پ.، سیدعلی خانی، س. ب.، شمسایی مهرجان، م.، سیدالحسینی، س. ه.، منوچهری، ح. 1399. تأثیر سطوح مختلف ترکیب اسیدهای آلی خوراکی بر برخی شاخص های رشد و ترکیبات لاشه بچه ماهی کپور معمولی. مجله علمی شیلات ایران. دوره 28. شماره 4. صفحه 35-43.
7-رهنما، ب.، اکرمی، ر.، چیت ساز، ح. 1392. تأثیر پربیوتیک اینولین بر عملکرد رشد، بازماندگی، ترکیب لاشه و مقاومت در برابر استرس در ماهی قرمز حوض(gibelio auratus Carassius). فصلنامه علوم تکثیر و آبزی پروری. دوره 1. شماره 2.  صفحه 70- 55.
8-سلیقه زاده، ر.، یاوری، و.، موسوی، س. م.، ذاکری، م. 1393. اثر مکمل غذایی جلبک اسپیرولینا (Spirulina platensis) بر برخی از فاکتورهای خونی، ایمنی و بیوشیمیایی سرم ماهی بنی(Mesopotamichthys sharpeyi). مجله دامپزشکی ایران. دوره10. شماره 2. صفحه 40-46.
9-سوداگر، م.، جعفری شموشکی، و.، حسینی، س. ع.، گرگین، س.، عقیلی، ک. 1387. اثر اسید آمینه های آسپارتیک و آلانین به عنوان ماده جاذب غذایی بر شاخص های رشد و بقا بچه فیل ماهیان (Huso huso). علوم کشاورزی و منابع طبیعی. دوره 15. شماره 1. صفحه 44-53.
10-ضاحی زاده، آ.، ذاکری، م.، موسوی، س. م.، کوچنین، پ.، سوری، م. 1399. اثرات سطوح مختلف مکمل خوراکی بایوترونیک تاپ 3 بر شاخص های رشد، تغذیه و ترکیبات بیوشیمیایی بدن میگوی پا سفید. شیلات مجله منابع طبیعی ایران. دوره 73. شماره 4. صفحه 515-527.
11-عشوری، ق. 1397. اثر مکمل‌سازی جیره با آلژینات سدیم با وزن مولکولی کم و پروبیوتیک Pediococcus acidilactici بر عملکرد رشد، پاسخ ایمنی غیر‌اختصاصی، دفاع آنتی‌اکسیدانی و فلور‌میکروبی روده سی‌باس آسیایی(Lates calcarifer, Bloch 1790). رساله دکتری، دانشگاه صنعتی اصفهان،  103 صفحه.
12-علیزاده، ح.، اورجی، ح.، فلاحتکار، ب. ، عفت پناه، ا. 1397. تاثیر سطوح مختلف اسید مالیک بر رشد و ترکیب لاشه بچه تاسماهیان سیبری(Acipenser baerii). مجله علمی شیلات ایران. دوره 27. شماره 6. صفحه 1-12.
13-محمدی، ح.، منوچهری، م. 1396. بررسی اثر سطوح مختلف اسیدی فایر بایوترونیک اس.ای. فورت بر شاخص های رشد و تغذیه و ترکیبات لاشه بچه ماهی بارب حلب. فصلنامه علوم تکثیر و آبزی پروری. دوره 14. شماره 12. صفحه 55-68.
14-نکوبین، ح.، حاجی مرادلو، ع.، حسینی فر، س. ح. 1399. اثر سطوح مختلف سرکه سیب بر برخی پارامترهای سیستم ایمنی غیراختصاصی سرم خون در بچه ماهیان کپورمعمولی(Cyprinus carpio). فصلنامه علمی پژوهشی محیط زیست جانوری. شماره 3. صقحه 323-328.
15.Adil, S., Banday, T., Bhat, G. A., Mir, M. S., Rehman, M. (2010). Effect of dietary supplementation of organic acids on performance, intestinal histomorphology, and serum biochemistry of broiler chicken. Veterinary Medicine International, 2010; 1-7.
16.Adel, A., Yeganeh, S., Dadar, M., Sakai, M., Dawood, M.A. (2016a). Effects of dietary Spirulina platensis on growth performance, humoral and mucosal immune responses and disease resistance in juvenile great sturgeon (Huso huso Linnaeus, 1754), Fish and Shellfish Immunology, 56; 436-444.
17.Ahmadifar E., Azari Takami G.H., Sudagar M. (2009). Growth performance, survival and immunostimulation, of beluga (Huso huso) juvenile following dietary administration of alginic acid (Ergosan). Pakistan Journal of Nutrition, 8(3); 227-232.
18.Ahmadniaye Motlagh, H., Sarkheil, M., Safari, O., Paolucci, M. (2020). Supplementation of dietary apple cider vinegar as an organic acidifier on the growth performance, digestive enzymes and mucosal immunity of green terror
 (Andinoacara rivulatus). Aquaculture Research, 51(1); 197-205.
19.Awad, E. Austin, D., Lyndon, A.R. (2013). Effect of black cumin seed oil (Nigella sativa) and nettle extract (Quercetin) on enhancement of immunity in rainbow trout, Oncorhynchus mykiss (Walbaum), Aquaculture, 388; 193-197.
20.Baruah, K., Sahu, N. P., Pal, A. K., Debnath, D., Yengkokpam, S., Mukherjee, S. C. (2007). Interactions of dietary microbial phytase, citric acid and crude protein level on mineral utilization by rohu, Labeo rohita (Hamilton), juveniles. Journal of the World Aquaculture Society, 38(2); 238-249.
21.Baruah, K., Sahu, N. P., Pal, A. K., Jain, K. K., Debnath, D., Mukherjee, S. C. (2007). Dietary microbial phytase and citric acid synergistically enhances nutrient digestibility and growth performance of Labeo rohita (Hamilton) juveniles at sub-optimal protein level. Aquaculture Research, 38(2); 109-120.
22.Berg, A., Hansen, T., Stefansson, S. (1992). First feeding of Atlantic salmon (Salmo salar L.) under different photoperiods. Journal of Applied Ichthyology, 8(1-4); 251-256.
23.Bradford, M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry, 72; 248-254.
24.Celik, K., Ersoy, I.E., Uzatici, A., Erturk, M. (2003). The using of organic acids in California turkey chicks and its effects on performance before pasturing. International Journal of Poultry Science, 2 (6); 448-446.
25.Di Marco, P., Priori, A., Finoia, M. G., Petochi, T., Longobardi, A., Donadelli, V. (2011). Assessment of blood chemistry reference values for cultured sturgeon hybrids (Acipenser naccarii female× Acipenser baerii male). Journal of Applied Ichthyology, 27(2);584-590.
26.Ellis, A.E. (1987). Inhibition of the Aeromonas salmonicida extracellular protease by a-2 macroglobulin in the serum of rainbow trout. Microbial Pathogenesis, 3; 167–177.
27.El-Sayed, Y. S., Saad, T. T. (2008). Subacute intoxication of a deltamethrin‐based preparation (butox® 5% ec) in monosex Nile Tilapia, Oreochromis niloticus L. Basic and Clinical Pharmacology and Toxicology, 102(3); 293-299.
28.El-Sayed, A. F. M., Ali, T. E. S., Eissa, M. A. R., Almisherfi, H. M. (2018). Correction to: Effects of dietary biogen and sodium butyrate on hematological parameters, immune response, and histological characteristics of Nile tilapia (Oreochromis niloticus) fingerlings. Aquaculture international, 26(1); 151-151.
29.Falahatkar, B., Poursaeid, S., Shakoorian, M., Barton, B.A. 2009 (). Responses to handling and confinement stressors in juvenile great sturgeon Huso huso. Journal of Fish Biology, 75; 784–796.
 
30.Harikrishnan, R., Kim, J.S., Balasundaram, C., Heo, M.S. (2012a). Dietary supplementation with chitin and chitosan on haematology and innate immune response in Epinephelus bruneus against Philasterides dicentrarchi. Experimental Parasitology, 131; 116-124.
31.Harikrishnan, R., Kim J., Balasundaram, C., Heo, M. (2012b). Immunomodulatory effects of chitinand chitosan enriched diets in Epinephelus bruneus against Vibrio alginolyticus infection. Aquaculture, 326; 46-52.
32.Hassaan, M. S., Wafa, M. A., Soltan, M. A., Goda, A. S., Mogheth, N. M. A. (2014). Effect of dietary organic salts on growth, nutrient digestibility, mineral absorption and some biochemical indices of Nile tilapia. Journal of Oreochromis Niloticus, 47-55.
33.Hjelmeland, K. (1983). Proteinase inhibitors in the muscle and serum of cod (Gadus morhua). Isolation and characterization. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry, 76(2); 365-372.
34.Hjelmeland, K., Christie, M., Raa, J. (1983). Skin mucus protease from rainbow trout, Salmo gairdneri Richardson, and its biological significance. Journal of Fish Biology, 23(1); 13-22.
35.Hosseini Shekarabi, S., Seyedalikhani, S., Shamsaie Mehrgan, M., Seyedalhosseini, S., Manouchehri, H. (2019). Effect of different levels of organic acids mixture on some growth parameters and carcass composition of common carp (Cyprinus carpio) juveniles. Iranian Scientific Fisheries Journal, 28(4); 35-43.
36.Hoseinifar, S. H., Safari, R., Dadar, M. (2017). Dietary sodium propionate affects mucosal immune parameters, growth and appetite related genes expression: Insights from zebrafish model. General and Comparative Endocrinology, 243; 78-83.
37.Hoseinifar, S. H., Zoheiri, F., Caipang, C. M. (2016). Dietary sodium propionate improved performance, mucosal and humoral immune responses in Caspian white fish (Rutilus frisii kutum) fry. Fish and Shellfish Immunology, 55; 523-528.
38.Iwama G. K., Vijayan M. M., Forsyth R. B., Ackerman P. A. (1999). Heat shock proteins and physiological stress in fish. American Zoologist, 39(6); 901-909.
39.John, P. J. (2007). Alteration of certain blood parameters of freshwater teleost Mystus vittatus after chronic exposure to Metasystox and Sevin. Fish physiology and Biochemistry, 33(1); 15-20.
40.Kasumyan, A.O., Nikolaeva, E.V. (2002). Comparative analysis of taste preferences in fishes with different ecology and feeding. Journal of Ichthyology, 42(2); S203..
41.Lim, A., Ekanayake, P., Abdullah, D. R. P., Lim, L. B. L., Bandara, J. S. (2015). Enhancement of sensitization capacity of dye from Melastoma malabathricum L. in DSSC by organic acid treatment. International Journal of Renewable Energy Research (IJRER), 5(4); 1112-1121.
42.Lückstädt, C. (2008). Effect of organic acid containing additives in worldwide aquaculture–sustainable production the non-antibiotic way. Acidifiers Anim Nutr, 71.
43.Lückstädt, C. (2008). Dietary organic acids as feed additive for tilapia (Oreochromis niloticus) culture. Mortality, 33(20.8b); 18-4b.
44.Magnadóttir, B., Jónsdóttir, H., Helgason, S., Björnsson, B., Jørgensen, T. Ø., Pilström, L. (1999). Humoral immune parameters in Atlantic cod (Gadus morhua L.): I. The effects of environmental temperature. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 122(2); 173-180.
45.Magnadóttir, B., Jónsdóttir, H., Helgason, S., Björnsson, B., Jørgensen, T. Ø., Pilström, L. (1999). Humoral immune parameters in Atlantic cod (Gadus morhua L.): II. The effects of size and gender under different environmental conditions. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 122(2); 181-188.
46.Magnadottir, B. (2010). Immunological control of fish diseases. Marine biotechnology, 12(4); 361-379.
47.Maslowski, K.M., Mackay, C.R. (2011). Diet, gut microbiota and immune responses. Nature immunology, 12(1); 5-9.
48.Menanteau-Ledouble, S., Krauss, I., Santos, G., Fibi, S., Weber, B.,  El-Matbouli, M. (2015). Effect of a phytogenic feed additive on the susceptibility of Onchorhynchus mykiss to Aeromonas salmonicida. Diseases of aquatic organisms, 115(1); 57-66.
49.Menanteau-Ledouble, S., Krauss, I., Goncalves, R. A., Weber, B., Santos, G. A., El-Matbouli, M. (2017). Antimicrobial effect of the Biotronic® Top3 supplement and efficacy in protecting rainbow trout (Oncorhynchus mykiss) from infection by Aeromonas salmonicida subsp. salmonicida. Research in Veterinary Science, 114; 95-100.
50.Miandare, H.K., Farahmand, H., Akbarzadeh, A., Ramezanpour, S., Kaiya, H., Miyazato, M. (2013). Developmental transcription of genes putatively associated with growth in two sturgeon species of different growth rate, General and Comparative Endocrinology, 182; 41-47.
51.Morgan, J., Mosawy, S. (2016). The potential of apple cider vinegar in the management of type 2 diabetes. International Journal of Diabetes Research, 5(6); 129-34.
52.Natrah, F.M.I., Alam, M.I., Pawar, S., Harzevili, A.S., Nevejan, N., Boon, N. (2012). The impact of quorum sensing on the virulence of Aeromonas hydrophila and Aeromonas salmonicida towards burbot (Lota lota L.) larvae. Veterinary Microbiology, 159(1-2); 77-82.
53.Nayak, S., Swain, P., Mukherjee, S. (2007). Effect of dietary supplementation of probiotic and vitamin C on the immune response of Indian major Carp, Labeo rohita (Ham.). Fish and Shellfish Immunology, 23; 892-896.
54.Ng, W. K., Koh, C. B. (2017). The utilization and mode of action of organic acids in the feeds of cultured aquatic animals. Reviews in Aquaculture, 9(4); 342-368.
55.Parma, M.J., Loteste, A., Campana, M., Bacchrtta, C. (2007). Chenges of hematological parameters in Prochilodus lineatus (pisces, Prochilodontidae) exposed to sublethal concentration of cypermethrin. Journal of Environmental Biology, 28(1); 147-149.
56.Pfaffl, M. W., Horgan, G. W., Dempfle, L. (2002). Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Research. 30; 36-36.
57.Pourmozaffar, S., Hajimoradloo, A., Miandare, H. K. (2017). Dietary effect of apple cider vinegar and propionic acid on immune related transcriptional responses and growth performance in white shrimp, Litopenaeus vannamei. Fish and Shellfish Immunology, 60; 65-71.
58.Reda, R. M., Mahmoud, R., Selim, K. M., El-Araby, I. E. (2016). Effects of dietary acidifiers on growth, hematology, immune response and disease resistance of Nile tilapia, Oreochromis niloticus. Fish and Shellfish Immunology, 50; 255-262.
59.Riemensperger, A.V., Bachinger, D., Schaumberger, S., Urbaityte, R., Pasteiner, S. (2012). The effect of an organic acid blend, cinnamaldehyde and a permeabilising substance on the inhibition of bacterial growth in vitro and growth performance of weaning pigs. Veterinary Medicine Zootech, 60; 59-66.
60.Ringø, E., Strøm, E. (1994). Microflora of Arctic charr, Salvelinus alpinus (L.): gastrointestinal microflora of free-living fish and effect of diet and salinity on intestinal microflora. Aquaculture Research, 25(6); 623-629.
61.Ringø, E., Olsen, R.E., Gifstad, T.Ø., Dalmo, R.A., Amlund, H., Hemre, G.I. (2010). Prebiotics in aquaculture: a review. Aquaculture Nutrition, 16(2); 117-136.
62.Robles, R., Lozano, A. B., Sevilla, A., Márquez, L., Nuez-Ortín, W., Moyano, F. J. (2013). Effect of partially protected butyrate used as feed additive on growth and intestinal metabolism in sea bream (Sparus aurata). Fish Physiology and Biochemistry, 39(6); 1567-1580.
63.Ross, N. W., Firth, K. J., Wang, A., Burka, J. F., Johnson, S. C. (2000). Changes in hydrolytic enzyme activities of naive Atlantic salmon Salmo salar skin mucus due to infection with the Salmon louse Lepeophtheirus salmonis and cortisol implantation. Diseases of aquatic organisms, 41 (1); 43-51
64.Sado, R.Y., Bicudo, Á.J.D.A., Cyrino, J.E.P. (2008). Feeding dietary mannan oligosaccharides to juvenile Nile tilapia, Oreochromis niloticus, has no effect on hematological parameters and showed decreased feed consumption. Journal of the World Aquaculture Society, 39(6); 821-826.
65.Safari, R., Hoseinifar, S. H., Kavandi, M. (2016). Modulation of antioxidant defense and immune response in zebra fish (Danio rerio) using dietary sodium propionate. Fish Physiology and Biochemistry, 42(6); 1733-1739.
66.Sajeevan, S., Varkey, A. M. T., Vadakkedath, M. (2014). Biometric parameters of the Redline torpedo fish Puntius denisonii Day 1865, an endemic barb in the western ghats hotspots of southern india. International Journal of Aquatic Biology, 2 (2); 75-84.
67.Salah A.M., Mohamed M.F., John G. (2008). Echinacea as immunostimulatory agent in Nile tilapia (Oreochromis niloticus) via earthen pond experiment. 8th international symposium on Tilapia in aquaculture, Egypt, 12-14 October, 1003- 1042.
68.Saurabh, S., Sahoo, P.K. (2008). Lysozyme: an important defense molecule of fish innate immune system. Aquaculture Research, 39; 223–239.
69.Shalaby, A. M., Khattab, Y. A., Abdel Rahman, A. M. (2006). Effects of Allium sativum and chloramphenicol on growth performance, physiological parameters and survival of Nile tilapia (Ooreochromis niloticus). Venomous Animals and Toxins Including Tropical Diseases. 12; 172-201.
70.Siwicki, A.K., Anderson, D.P. (1993). Nonspecific defense mechanisms assay in fish: II. Potential killing activity of neutrophils and macrophages, lysozyme activity in serum and organs and total immunoglobulin level in serum. Fish Disease Diagnosis and Prevention Methods Olsztyn, Poland,105-12.
71.Subramanian, S., MacKinnon, S. L., Ross, N. W. (2007). A comparative study on innate immune parameters in the epidermal mucus of various fish species. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 148(3); 256-263.
72.Tohidi, M., Harati, H., Hadaegh, F., Mehrabi, Y., Azizi, F. (2008). Association of liver enzymes with incident type 2 diabetes: A nested case control study in an Iranian population. BMC Endocrine Disorders, 8(1); 1-6.
73.Zhang, L., Zhang, P., Xia, C., Cheng, Y., Guo, X., Li, Y. (2020). Effects of malic acid and citric acid on growth performance, antioxidant capacity, haematology and immune response of Carassius auratus gibelio. Aquaculture Research, 51(7); 2766-2776.