بررسی بیان ژن های مرتبط با تنش در گوسفندان آمیخته و بومی

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشگاه محقق اردبیلی- اردبیل- ایران

2 عضو هیات علمی، گروه علوم دامی، دانشکده کشاورزی، دانشگاه محقق اردبیلی

3 عضو هیئت علمی، گروه علوم دامی، دانشکده کشاورزی، دانشگاه محقق اردبیلی

4 گروه علوم دامی و صنایع غذایی، دانشکده کشاورزی و منایع طبیعی، دانشگاه محقق اردبیلی، اردبیل، ایران

چکیده

زمینه و هدف: افزایش دمای هوا و خشک شدن مراتع حیوانات را دچار تنش آبی و تغذیه ای می کند. در این پژوهش ژن‌های کنترل کننده مقاومت در گوسفندان دورگ و بومی مورد بررسی قرارگرفت.
روش کار: در این تحقیق از ده بره‌ ی نر آمیخته رومانف و بومی و ده بره نر خالص بومی در 4 تیمار و 5 تکرار در هر گروه استفاده شدکه در دوگروه با محدودیت آبی و بدون محدودیت آبی تقسیم شدند در پایان آزمایش نمونه‌ها ی بافت کبد از حیوانات کشتار شده جمع آوری و بعد از استخراج RNA و پاکسازی نمونه ها انجام واکنش Real Time PCR توالی و طول قطعه های مورد نظر بررسی قرار گرفت و برای آنالیز آماری از روش آنالیز فاکتوریل 2×2 در قالب طرح کاملاً تصادفی با استفاده از نرم افزار آماری SAS استفاده گردید.
یافته ها: با استخراج ژن ها مشخص گردید میزان بیان ژن های، NRT2, PRKAA1, SIRT3, TFAM,GPX1 در شرایط تنش در گوسفندان بومی نسبت به گوسفندهای آمیخته افزایش داشته است.
نتیجه گیری: مطالعات انجام یافته بر روی بیان ژن های،  PRKAA1, NRT2,GPX1,TFAM SIRT3در کبد دو گروه گوسفند بومی و دورگ در شرایط تنش و نرمال چنین استنباط شد که در شرایط استرس این چهار گروه ژن با مقابله با اکسیداسیون اکسیداتیو و ذخیره انرژی و جلوگیری از اتلاف انرژی و محافظت از سلول, مقاومت حیوان را در برابر شرایط تنش افزایش می دهند با توجه به سازگاری ژنتیکی گوسفندهای بومی با شرایط بیابانی منطقه, سبب مقاومت بیشتر حیوان در برابر گرما و بیماری می گردد.

کلیدواژه‌ها


عنوان مقاله [English]

Investigation of gene expression related to stress in native and cross breed sheep

نویسندگان [English]

  • Neda Ruh bakhsh 1
  • nemat hedayat evrigh 2
  • Reza Seyed sharifi 3
  • Mir Darioush Shakouri 4
1 University of Mohaghegh Ardabili-Ardabil-Iran
2 Associate Professorin Animal Science, University of Mohaghegh Ardabili, Ardabil, Iran 2- Assistant Professors, Animal Science
3 Associate Professorin Animal Science, University of Mohaghegh Ardabili, Ardabil, Iran
4 Department of Animal Science and Food Industry, Faculty of Agriculture and Natural Resources, Mohaghegh Ardabili University, Ardabil, Iran
چکیده [English]

Inroduction & Objective: Increasing in temperature and drying of pastures cause water and nutritional stress to animals. In this study, resistance control genes in crossbred and native sheep were examined.
Material and Methods: In this study, ten cross of Romanov native male lambs and ten purebred male native lambs in 4 treatments and 5 replications in each group were used. They are divided into two groups with normal and water restriction condition. At the end of the experiment, liver tissue samples were collected from slaughtered animals and it was kept in liquid nitrogen, to investigation of gene expression whole RNA was extracted and purified and the cDNA was synthesis. In the end Real Time PCR reaction were performed using specific primers.  For statistical analysis we used randomized design as factorial analysis method using SAS 9.2.
Results: By extracting the genes, it was found that the expression of GPX1, TFAM, SIRT3, PRKAA1, NRT2 genes increased under stress in native sheep compared to crossbred sheep.
Conclusion: The expression of GPX1, TFAM, NRF2, SIRT, PKAA1 genes in the liver of two groups of native and crossbred in normal and stress conditions indicate that Under stress, these four groups of genes act as oxidative process and store energy and prevent energy loss and protect the cell. Due to the genetic compatibility of native sheep with the drought conditions of the region, it makes the animal more resistant to heat and disease.

کلیدواژه‌ها [English]

  • Crossbred Sheep
  • Native Sheep
  • Stress
  • Gene expression

مقدمه

 

کشور ایران کشوری نیمه خشک بوده و مناطق بیایانی و کویری سطح وسیعی از فلات مرکزی ایران را تشکیل می دهد(1) و دام های اهلی نقش اقتصادی مهمی در توسعه کشور ایفا می کنند و برای تامین نیازهای غذایی جمعیت روستایی وشهری ضروری هستند(19). نوشیدن آب یک نیاز مهم برای دام است و عدم وجود منبع کافی آب می تواند یک عامل محدود کننده در حیوانات از نظر فیزیولوژی و بهره وری باشد. آب، به عنوان یک ماده ضروری برای حفظ تعادل گرمایی بدن و حلال اصلی برای مایعات داخل و خارج سلولی ضروری است. و نود درصد پلاسمای خون را تشکیل داده و برای جریان خون در حیوانات شیرده ضروری می باشد. گونه های مختلف جانوری در رابطه با مناطق جغرافیایی مبدأ، تفاوت های قابل توجهی در استفاده ازآب دارند آب ماده مغذی اساسی برای تولید حیوانات بوده، اما در دسترس بودن آن عامل محدود کننده دام در مناطق خشک و نیمه خشک جهان است(2). حیواناتی که در بیابان ها و مناطق خشک زندگی می کنند انواع مختلف مکانیسم های سازگاری را به دست آورده اند و قادر به حفظ آب و استفاده مؤثر از ذخایر بدنی هستند(25). موثرترین روش برای به حداکثر رساندن بهره وری در مناطق نیمه بیابانی و مناطق دچار محدودیت آب، انتخاب نژادهایی است که با شرایط سازگارتر هستند و برای تولید عادی، کمتر وابسته به آب می باشند(15). یکی از مکانیسم های پشتیبانی در دسترسی کم به آب، کاهش جذب خوراک است که منجر به کاهش متابولیک وباعث بهبود قابلیت هضم خوراک می­شود از آن جا که حیوان در فرآیند هضم حرارت کمتری ایجاد می کند، تبخیر و تعرق در دمای محیطی بالا کاهش پیدا می یابد(26). کاهش مصرف خوراک در طولانی مدت باعث کاهش وزن بدن و ارگان های حیوان از جمله قلب و کلیه ها می شود(6،10). کمبود این مواد مغذی بر هموستاز، وزن بدن، تولید مثل و بیماری تاثیر منفی دارد. علاوه بر این ممکن است اثر منفی بر کیفیت گوشت داشته باشد(4). بررسی اثرات محدودیت آبی و غذایی روی استرس اکسیداتیو و میزان بیان آنزیم های آنتی اکسیدانی اصلی روی کبد بره گوسفند HU نشان می­دهد که باعث افزایش سطح mRNA ژن GPX1 می شود(16). TFAM فاکتور رونویسی میتوکندری و پروتئین اتصالی mtDNA میتوکندری است که برای شروع رونویسی و نگهداری ژنوم ضروری است و تعداد کپی mtDNA را تنظیم می­کند، از جمله ژن هایی که فعالیت رونویسی و تکثیر میتوکندری را تنظیم می کند(5). TFAM نقش مهمی در پاسخ التهابی ناشی از استرس در mtDNA داردو با توجه به این که یک پروتئین کلیدی در نگهداری mtDNA دارد. خاموش شدن TFAM در موش ها با استفاده از روش Cre –loxp منجر به مرگ و میر جنینی واز بین رفتن mtDNA می شود(20). پروتئین کیناز فعال حس­گر انرژی است که نقش مهمی در متابولیسم انرژی سلولی ایفا می­کند. در پاسخ به کاهش سطح ATP داخل سلولی، مسیرهای تولید انرژی را فعال می کند و فرآیندهای مصرف انرژی نظیر بیوسنتز پروتئین، کربوهیدرات و لیپیدها ، و هم چنین رشد سلول و تکثیر را مهار کرده سلول­ها را از فشارهای ناشی از کاهش ATP محافظت می­کند(6). بیان این ژن به صورت پویا در کبد تنظیم شده است(12). GPX1 که یک ایزوآنزیم است ویژگی های سوبسترای مختلفی دارد. استرس اکسیداتیو به همراه تشکیل گونه های اکسیژن واکنش پذیر یکی از مولفه های اصلی التهاب است، این ژن از هموگلوبین گلبول های قرمز در برابر تجزیه اکسیداتیو محافظت کرده و به H2O و O2 تبدیل می کند. بنابر این از مرگ سلولی جلوگیری می­نماید(28). ژن دیگری که در همه بافت ها بیان می شود، Nrf2 است. فاکتور رونویسی رمزگذاری شده توسط این ژن، ژن هایی را که حاوی عناصر پاسخ آنتی اکسیدانی در پروموتورهای خود هستند را تنظیم می کند(11). بنابراین نقش مهمی در سم زدایی سلول دارد. کبد محل اصلی برای سوخت و ساز مواد مغذی، داروها و مواد شیمیایی است و معمولاً حاوی سلول های ایمنی بسیاری است که مسئول پاکسازی آنتی ژن های خارجی هستند(13) و فنوتیپ های مشاهده شده در بیان ژن در کشف مکانیسم­های مولکولی که منجر به آسیب کبدی می شوند، مفید است(10). به همین علت اکثر تحقیقات بر روی کبد انجام می گیرد. با توجه با خصوصیات گوسفندان بومی و شرایط اقلیمی ایران برای اصلاح نژاد گوسفند تاکید بر نژاد های بومی کشور که با محیط سازگار می باشند از طرف دیگر استفاده از نژادهای چند قلو زا برای افزایش تعداد نتاج یک موضوع قابل توجه است، زیرا راندمان گوسفند سه قلو به دوقلو بیست درصد و راندمان دوقلو به یک قلو پنج تا سی و پنج درصد بیشتر است. هدف از این پژوهش بررسی ژن­های کنترل کننده مقاومت در گوسفندان بومی وآمیخته می باشد تامیزان مقاومت این دو گروه را در شرایط تنش آبی است.

مواد و روش ها

 بخش فارم این آزمایش از اواسط تیر تا اواسط شهریور انجام شد. در این آزمایش از ده بره‌ی نر آمیخته رومانف و ده بره نر خالص در 4 تیمار و 5 تکرار در هر گروه استفاده شد. طول مدت آزمایش شش هفته(42 روز) در فصل گرم سال بوده و حیوانات در باکس‌های انفرادی و در مکان مسقف نگه­داری شدند. براساس داده‌های هواشناسی و نیزاز فرمول شاخص حرارتی-رطوبتی Maraiبرای گوسفندان مشخص شد آیا این حیوانات در استرس گرمایی هستند یا خیر(18). شاخص رطوبتی کمتر از 19/22 بدون استرس گرمایی، 2/22 تا 29/23 دارای استرس گرمایی متوسط، 25/29 دارای استرس گرمایی شدید، 3/25 و بیش‌تر استرس خیلی شدید توصیف گردید. آنالیز داده های شاخص حرارتی-رطوبتی نشان داد که حیوانات تحت پرورش در طول دوره پرورش در استرس گرمایی متوسط تا شدید قرار داشتند.آنالیز داده­های شاخص حرارتی- رطوبتی نشان داد که حیوانات تحت پرورش در طول دوره پرورش در استرس گرمایی متوسط تا شدید قرار داشتند(شکل1). در این شکل استرس گرمایی در سه حالت ملایم، متوسط و شدید تقسیم بندی شده است که همان طور که ملاحظه می­شود هیچ کدام از نواحی خالی از اعداد نیست و تمامی گوسفندان نوعی از استرس را تجربه کرده اند وحیوان بدون استرسی وجود ندارد. آب تازه در سطل های 5/1 به صورت انفرادی به حیوان عرضه شد. در تیمارهای بدون استرس آبی دو بار در روز در ساعت هشت و چهار و نیم به حیوانات عرضه شد و از مجموع میزان مصرف آب صبح و عصر میزان مصرف کل روز به دست آمد. حیوانات دارای استرس آبی یک ساعت بعد ازخوراک عصر و به مدت یک ساعت آب مصرف کردند(شروع از ساعت 5 و خاتمه در ساعت 6 بعد از ظهر). در پایان آزمایش حیوانات کشتار شدند و نمونه ها از یک نقطه مشخص از بافت کبد جمع آوری شده و بعد از قرار دادن در کرایوتیوپ ها به منظور کاهش آسیب بافتی در ازت مایع قرار گرفتند. در آزمایشگاه تا زمان انجام آزمایشات مربوط به بیان ژن در یخچال منفی هفتاد درجه سانتی گراد نگهداری شدند. استخراجRNA با استفاده از دستور کار شرکت یکتا تجهیز آزما به شرح زیر انجام گرفت. مقدار 30-50 میلی گرم از بافت کبد پس از افزودن نیتروژن مایع در بوته چینی با استفاده از هاون به شکل پودر و سفید درآمد سپس نمونه ها به داخل تیوپ 1.5 میلی لیتری انتقال یافته و یک میکرولیتر از PLUS RNX به روی نمونه افزوده شد و پس از هموژنایز کامل محلول جهت لیزشدن نوکلئوپرو تئین در دمای اتاق به مدت پنج دقیقه قرار گرفت، سپس به میزان 200 میکرولیتر کلروفرم اضافه و به مدت پانزده ثانیه مخلوط را ورتکس کرده و به مدت سی دقیقه در دمای اتاق قرار داده شد سپس نمونه ها داخل سانتریفیوژ با دور 12000 در دمای چهار درجه سانتی گراد به مدت ده دقیقه سانتریفیوژ شدند پس از این که نمونه ها در سه فاز متمایز تشکیل گردید مایع رویی را با سمپلر جمع آوری و داخل میکرو تیوپ جدید ریخته شد و برابر با حجم مایع اتانول مطلق اضافه گردیده به خوبی ورتکس و مخلوط گردد سپس ستون FARB را روی تیوپ قرارداده و مخلوط با سرعت 15000 دور به مدت یک دقیقه سانتریفیوژ گردید مایع خروجی داخل تیوپ بیرون ریخته و میزان 500 میکرولیتر بافر شستشو دهنده 1 به داخل ستون FARB اضافه گردید و با سرعت کامل به مدت یک دقیقه سانتریفیوژ شد مایع داخل تیوپ دور ریخته 750 میکرولیتر بافرشستشو دهنده 2 به داخل ستون اضافه شد و با سرعت کامل به مدت یک دقیقه سانتریفیوژ گردید مرحله قبل دوباره تکرار شد سپس محلول داخل تیوپ بیرون ریخته شد و ستون FARB بدون اضافه کردن هر نوع محلولی به مدت سه دقیقه با سرعت کامل سانتریفیوژ گردید. ستون FARB به داخل میکروتیوپ 5/1میلی لیتری داخل کیت انتقال داده و میزان 70 میکرولیتر بافر الوشن اضافه گردید به مدت یک دقیقه در دمای اتاق قرار گرفته به مدت یک دقیقه با سرعت کامل سانتریفیوژ شده به دمای 70منفی درجه سانتی گراد انتقال یافت. جهت بررسی کیفیت RNA استخراج شده از ژل آگارز دو درصد استفاده گردید. برای پاکسازی نمونه از هر گونه آلودگی DNA از کیت DNAsel, RNA ase free شرکن سینا کلون استفاده شد. این کیت دارای بافر EDTA، Mgcl2 50 مولار و DNAsel , RNAse-free شرکت سینا کلون استفاده شد. پس از یخ گشایی RNAها و اجزای کیت به میزان یک میکرولیتر RNA ویک میکرولیتر بافر واکنش,Mgcl2 نیم میکرولیتر از DNAsel RNAfree و هفت و نیم میکرولیتر آب بدون RNase(حجم نمونه برابر ده میکرولیتر) در تیوپ 2/0 میلی لیتری ریخته به مدت سی دقیقه در دمای 37 درجه سانتی گراد داخل دستگاه ترمال سایکلر قرار گرفت، سپس در زیر هود وروی یخ به میزان یک میکرولیتر EDTA اضافه شده و به مدت ده دقیقه در دمای 65 درجه سانتی گراد داخل دستگاه ترمال سایکلر قرار گرفت وتا زمان ساخت cDNA به داخل یخچال منفی هفتاد منتقل شد. برای ساخت Cdna از کیت مربوط به شرکت سینا کلون استفاده گردید. این کیت شامل رندوم هگزامر و بافر واکنش گر و dNTP و بافر آغازگر و بافر تثبیت کننده هست. در آخرین مرحله از واکنش برای بررسی تکثیر ژن­ها از Real Time PCR استفاده شد. برای انجام این واکنش از آغازگرهای اختصاصی شرکت سینا کلون استفاده گردید. با استفاده از اطلاعات بانک ژنی NCBI توالی و طول قطعه های مورد نظر بررسی شد.

 

 

 

 

شکل1-بررسی دما، رطوبت و تنش

 

 

شکل 2- RNA بارگذاری شده روی ژل آگارز دو درصد

 

جدول1- توالی آغازگرهای استفاده شده دراین پژوهش

ژن

شماره ثبت در بانک ژنی

جهت

توالی آغازگر

TFAM

XM-15104510.1

رفت

CGCTCCCCCTTTAGTTTTGC

 

 

برگشت

CTGCCAGTCTGCCCTGTAAG

PRKAA1

XM_004017019.2

رفت

TTGCGTGTTCGGAGGAAGAA

 

 

برگشت

GGCGTAGCAGTCCCTGATTT

SIRT3

XM_004019744.3

رفت

GCCCAATGCCACTCACTACT

 

 

برگشت

GGGATGCCAGATGCTCTCTC

GPX1

JF728302.1

رفت

GCAACCAGTTTGGGCATCAG

 

 

برگشت

GCCATTCACCTCGCACTTTT

NRF2

AY369137.1

رفت

CGGAAGAGACAGCAAACACG

 

 

برگشت

TTCCGTGGCCCAGTGTAAAG

NRF1: Nuclear respiratory factor 1    TFAM: Transcription factor A, mitochondrial

PRKAA1: Protein kinase, AMP-activated, alpha 1 catalytic subunit    SIRT3: Sirtuin 3

GAPDH: Glyceraldehyde −3- phosphate dehydrogenase

 

 

برای عملکرد بهتر واکنش دهنده ها در حجم بیست و پنج میکرولیتر مستر میکس سایبرگرین(Master Mix 2)، یک و نیم میکرولیتر  cDNAو یک میکرولیتر آغازگر رفت و یک میکرولیترآغازگر اختصاصی برگشت و نه میکرولیتر آب بدون RNA تهیه شد. در روی رک فلزی به تیوپ های 2/0 میلی لیتری اضافه شد و به ازای هر نمونه بیست و پنج میکرولیتر آب مقطر به تیوپ ریخته شد. هم چنین یک بار هم نمونه با حجم بیست و پنج بدون پرایمر تهیه گردید که به ازای دو میکرولیتر پرایمر دو واحد آب مقطر اضافه و در دستگاه RotorGene 3000 قرار داده شد مقدار نور ثبت شده بستگی به مقدار محصول به دست آمده دارد. تعیین کمی سطحوح این ژن ها با استفاده از روش لیواک محاسبه شد و بیان نسبی ژن های نامبرده با فرمول 2 –ΔΔct محاسبه گردید(15). آنالیز آماری از روش آزمون فاکتوریل 2×2 در قالب طرح کاملاً تصادفی با استفاده از نرم افزار آماری SAS نسخه 2/9 رویه GLM استفاده گردید. میانگین نمونه ها با استفاده ازآزمون توکی و تمایل به معناداری05/0 P< گزارش گردید.

نتایج

نتایج حاصل از تکثیر آغازگرها نشان داد که پرایمرها به خوبی کار کرده و نتایج حاصل از دقت و اختصاصی کافی برخوردار بوده است(نمودار 1 و 2 و 3). همان طور که در نمودار ذکر شده مشاهده می گردد چرخه ها با دقت کامل نمایش داده شده است و مقدار ct به راحتی قابل تفکیک است. در مطالعه اخیر نقش محدودیت آبی در گوسفندان بومی وآمیخته در شرایط تنش و نرمال مورد بررسی قرار گرفت و بیان ژن های، SIRT3، TFAM، NRF2،GPX1 ،PRKAA  در دو گروه گوسفند مقایسه گردید. آزمایش نشان داد که بیان ژن GPX1 گوسفندان بومی 71/2 برابر در مقایسه با گوسفندان آمیخته بیشتر است(نتیجه آزمایش هم چنین نشان دادکه بیان ژن های، TFAM،SIRT3 ،PRKAA1 ، NRF2 در گوسفندان آمیخته در مقایسه باگوسفندان بومی تفاوت معناداری را نشان نمی­دهد. نتیجه آزمایش نشان داد که میزان بیان ژن GPX1 درگوسفندان تحت تنش در مقایسه با گوسفندان در شرایط نرمال بیشتر است(نمودار 4). در آزمایشی که صورت گرفت نتیجه آزمایش نشان داد که بیان ژن TFAM در گوسفندان تحت تنش 43/2 برابر در مقایسه با گوسفندان در شرایط نرمال بیشتر است که تلاش این ژن برای مقابله جاندار با شرایط تنش و ادامه دادن به رشد نرمال می باشد(نمودار 5). نتیجه آزمایش نشان دادکه بیان ژن NRF2 در گوسفندان تحت تنش 49/ 4 برابر در مقایسه با گوسفندان در شرایط نرمال بیشتر است. با توجه به نقشی که این ژن در سم زدایی سلول و رشد حیوان دارد افزایش این ژن در شرایط استرس باعث رشد طبیعی حیوان و متابولیسم عادی کبد می شود. هم چنین نشان داده شد بیان ژن sirt3 در گوسفندان تحت تنش 38/2 برابر در مقایسه با گوسفندان در شرایط نرمال بیشتر است. این ژن با تنظیم مسیر سیگنالینگ میتوکندری باعث تنظیم انرژی تولیدی شده و نیاز جاندار برای رشد عادی را رفع می‌کند(نمودار6). در بیان ژن PRKAA1 درگوسفندان تحت تنش در مقایسه با گوسفندان در شرایط نرمال تفاوت معناداری را نشان نمی دهد(05/0≤ p). در بررسی اثرات متقابل تنش و نژاد مشخص گردید در شرایط نرمال میزان بیان ژن GPX1 در هر دو گوسفند به یک میزان افزایش یافته در حالی که در شرایط تحت تنش در گوسفندان بومی افزایش قابل ملاحظه ای دیده شد(نمودار7). در این آزمایش هم چنین نشان داده شد در شرایط نرمال میزان افزایش ژن TFAM وNRF2 در هر دو نژاد گوسفند به یک میزان افزایش داشته است در حالی که در شرایط تنش میزان بیان این ژن در گوسفندان بومی بیشتر بوده است(نمودار8 و9). با توجه به نقشی که ژن SIRT3 به عنوان سنسور نسبی NAD (+) / NADH دارد با محرومیت گلوکزو تغییرات متابولیکی مرتبط با محدودیت کالری تغییر می کندو می تواند در شرایط تنش مثل کم آبی با تنظیم سطح NAD + برای تنظیم عملکرد میتوکندری کبد را در برابر آسیب کبدی مرتبط با کبد چرب محافظت کند(نمودار9). در این شکل خط عمودی، نشان دهنده ژن و خط افقی نشان دهنده نژاد می باشد که سمت راست گوسفند بومی و سمت چپ گوسفند آمیخته را نشان می‌دهد و همچنین خط قرمز نشان دهنده شرایط نرمال و خط آبی نشان دهنده شرایط تنش می باشد. همان طور که مشخص است در حالت تنش میزان بیان این ژن در گوسفندان بومی افزایش داشته است. در نمودار10میزان بیان ژن PRKAA1 در شرایط نرمال و تنش در دو گوسفند بومی و آمیخته آورده شده که نشان می دهد در شرایط نرمال بیان این ژن در گوسفندان آمیخته بیشتر از نرمال بوده در حالی که در شرایط استرس میزان بیان این ژن در گوسفندان بومی بالاتر بوده این نمودار نشان دهنده این است که حیوانات در شرایط مختلف واکنش مختلفی از خود نشان می دهند. با توجه به این که دورگ گیری اخیراً زیاد شده است و از طرفی اکثر ژن های مورد بررسی در بین نژادها تفاوت معنی داری نداشتند شاید بتوان استنباط کرد که دام های آمیخته به مانند بومی می توانند شرایط تنش محیطی به طور نسبی تحمل کنند و از طرف دیگر دارا بودن شرایط مطلوبی مانند چند قلوزایی در این گوسفندان بتوان گوسفندان مقاومی با تولید بالا ایجاد کرد(نمودارهای11، 12، 13).

 

جدول2- چرخه حرارتی به کار رفته دستگاه Real-time pcr

گامه

تکرار چرخه

شرح گامه

دما(سانتی گراد)

زمان

چرخه

1

فعال سازی حرارتی اولیه

95

6 دقیقه

چرخه

40

باز شدن رشته ها

95

15 ثانیه

چسبیدن آغازگرها و تکثیر

62

30ثانیه

72

45 ثانیه

منحنی ذوب

افزایش تدریجی دما تا 80 درجه سانتی گراد

 

نمودار 1- منحنی تکثیر واکنش Real-Time PCR

نمودار 2- مدل یک ازمنحنی نقطه ذوب واکنش Real-Time PCR

 

نمودار3- مدل دو از منحنی ذوب واکنش Real-Time PCR

b

a

                           

نمودار4- مقایسه تاثیر نژاد بربیان نسبی ژن GPX1 در بین دوگروه بومی و آمیخته.

 

b

a

 

 

نمودار5- مقایسه تاثیرکم آبی بربیان نسبی ژن GPX1 در بین گوسفندان

 

 

b

p≤0/05

a

  

نمودار6- مقایسه تاثیر کم آبی بر بیان نسبی ژن TFAM در شرایط نرمال و تنش.

 

p≤0.05

b

 

a

 

نمودار7-مقایسه تاثیرکم آبی بر بیان نسبی ژن NRF2 در دو گروه نرمال و تحت تنش.

p≤0.05

 

b

 

 

نمودار8- مقایسه تاثیر کم آبی بربیان نسبی ژنSIRT3در شرایط نرمال و تنش.

.

 

 

جدول2- مقایسه بیان نسبی ژن­ها در نژاد آمیخته و بومی و شرایط تحت تنش و نرمال

تیمار

GPX1

TFAM

NRF2

SIRT3

PRKAA1

نژاد    بومی

37/3

51/2

49/4

53/2

41/4

         آمیخته

24/1

33/1

70/2

2

13/5

تنش کم آبی

53/3

48/2

89/5

19/3

03/6

          نرمال

08/1

02/1

31/1

34/1

51/3

ارزش     نژاد

03/0

06/0

21/0

45/0

67/0

P         تنش

01/0

005/0

003/0

01/0

14/0

        اثر متقابل

05/0

14/0

15/0

21/0

03/0

             

 

 

 

 

P≤0.05

 

 

نمودار9- اثرمتقابل بین نژاد وتنش آبی دربیان ژن Gpx1.

 

P≤0.05

 

 

نمودار 10- اثرمتقابل بین نژاد وتنش آبی دربیان ژن TFAM

P≤0.05

 

نمودار11- اثرمتقابل بین نژاد وتنش آبی دربیان ژن NRF2

 

P≤0.05

 

نمودار12- اثرمتقابل بین نژاد وتنش دربیان ژن Sirt3

 

 

P≤0.05

 

نمودار13- اثرمتقابل بین نژاد وتنش آبی دربیان ژن    PRKAA1

 

 

 

جدول 3- بررسی اثرات متقابل نژاد و محیط در بیان ژن ها

نژاد

تنش آبی

GPX1

TFAM

NRF2

SIRT3

PRKAA1

بومی

نرمال

b   98/0

a    88/3

b   45/1

b15/1

b20/1

 

تنش آبی

b   49/1

b    15/1

ab 95/3

a    90/3

a     62/7

آمیخته

نرمال

b   17/1

ab   80/1

b   16/1

ab 52/1

a    81/5

 

تنش آبی

a  57/5

b    87/0

a   82/7

ab 48/2

a45/4

SEM

 

97/0

605/0

41/1

695/0

69/1

میانگین اشتباه

معیار

 

 

 

 

 

P

 

49/0

038/0

019/0

46/0

03/0

 

بحث و نتیجه گیری

با توجه به مطالعات انجام یافته بر روی بیان ژن های، SIRT3، NRF2،TFAM ،PRKAA1 ،GPX1، در کبد دو گوسفند بومی و آمیخته در شرایط تنش و نرمال مشخص شد که تفاوت های ژنتیکی در نژاد های مختلف در زمینه مقاومت در برابر شرایط تنش چشمگیر بوده و این تفاوت ها ناشی از اکتساب ژن هایی هست که باعث مقاومت یک نژاد  در برابر تنش می شود. این سازگاری به فعالیت های سلولی حیوان وابسته بوده و امکان ادامه حیات و بهبود تولید را در شرایط نامساعد مانند تنش حرارتی فراهم می سازد. گوسفندان بومی یک منطقه با ترشح آنزیم ها و هورمون های مختلف تعادل سیستم بدنی خود را حفظ می کنند و با عواملی نظیر استفاده ازمخزن آبی خود وکاهش جذب خوراک در نتیجه کاهش تولید حرارت و تعریق و نیز با افزایش ترشح برخی از ژن ها خود را با محیط تطبیق می دهند. مطالعات قبلی نشان می دهد محدودیت آبی دو روزه در بزها موجب کاهش ده در صدی خوراک می شود و با پیشرفت کم آبی میزان مصرف آب نیز در آن ها کاهش می یابدکه می تواند نتیجه جلوگیری از هدر رفتن آب از شکمبه باشد. بزهای سازگار مانند بز سیاه توانایی حفظ تولید شیر تا دو روز بدون آب را دارند(3). همان طور که اشاره شد در شرایط استرس این چهار گروه ژن با مقابله با اکسیداسیون اکسیداتیو و ذخیره انرژی و جلوگیری از اتلاف انرژی و محافظت از سلول، مقاومت حیوان را در برابر شرایط تنش افزایش می دهند در کبد گوسفند بره HU نیز پژوهش ها نشان دهنده برگشت به تعادل میزان TFAM بعد از دوران محدودیت غذایی و افزایش تعداد نسخه برداریmtDNA و میزان mRNA ژن SIRT3 در دوران محدویت می باشد. سطح NAD میتوکندری توسط این ژن تنظیم می­شود. هیچ اثر قابل توجهی روی استرس اکسیداتیو در کبد ملاحظه نشد( 17). در پژو هش های انجام یافته مشخص شد یکی از دلایل احتمالی افزایش فعالیت این ژن در محدودیت غذایی افزلیش فعالیت PPARGC1A استSIRT3 .نقش اصلی را در تنظیم انرژی دارد و موجب فسفوریلاسیون AMPK میشود(23). محدودیت غذایی محتوای mtDNA را تحت تاثیر قرار می دهد و ارتباط مستقیم بین TFAMو mtDNA. وجود دارد. میتوکندری مهم ترین منبع تامین انرژی سلول است. آسیب به میتوکندری سبب اختلال در فعالیت های سلول می‌شود. با توجه به نقشی مهمی که TFAM در استرس دارد باعث حفظ رونویسی DNA میتوکندری می شود و نقش حفاظتی برای سلول دارد از پیری جلوگیری کرده و باعث رشد طبیعی جاندار در شرایط تنش زا می شود. در محدودیت آبی و غذایی تغییرات کمی از نظر اتصال TFAM و mtDNA دیده شد. بیان ژن های بیوژنز میتوکندری مثل NRF1 وTFAM  و تعداد کپی mtDNA  در این شرایط به طور قابل توجهی افزایش می یابد. که نتیجه این آزمایش نیز میزان افزایش این ژن در شرایط تنش نشان داده شد. در طی دوره های طولانی مدت کمبود تغذیه ای بیان GAPDH در کبد القا می شود(29). ژن گلوتاتیون پراکسیداز1(GPX1) آنزیم های آنتی اکسیدانی را در سلول فعال می کند و نقش مستقیمی در از بین بردن اکسیژن فعال تولید شده دارد. بنابراین سلول را سم زدایی کرده و از مرگ سلولی جلوگیری می کند در نتیجه موجب محافظت کبدی بیشتر و رشد بهتر گوسفند بومی می شود. به نظر می رسد این ژن در حیوانات بومی بیشتر بیان می شود که می تواند به دلیل سازگاری دام های بومی به تنش های محیطی ذکر کرد Sun  و همکاران(2020) نشان دادند که ژن GPX1 در کنار Per1 در زمان که حیوان دچار استرس می شود با افزایش میزان بیان منجر به ایجاد فعالیت اکسیداتیو در سلول می گردد(27). ازآن جایی که شرایط استرس زا برای حیوان موجب استرس اکسیداتیو می شودکه برای سلول ها سمی می باشد این ژن با تجزیه سریع پراکسید هیدروژن تولید شده به دو تا آب، سلول را سریع سم زدایی کرده باعث رشد نرمال حیوان در شرایط استرس زا می شود. لذا در شرایط تنش زای تفاوت بیان معنی داری مشاهده می گردد. وینگر و همکاران(2021) گزارش کردند که استرس ملایم به موش صحرایی منجر به افزایش ژن GPX1 می شود(30). ژن فاکتور رونویسی میتوکندریایی A (TFAM)نقش مهمی را در تنظیم، رونویسی، هماندسازی و نگهداری DNA میتوکندری ایفا می کند این ژن در حدود 253 اسیدآمینه را کد می نماید در این مطالعه نشان داده شد که این ژن با افزایش معنی دار میزان بیان به اندازه 43/2 می باشد. فنگ و همکاران(2020) افزایش معنی داری بیان ژن TFAM در زمان استرس اکسیداتیو را گزارش کردند(14). در حالی که وو و همکاران(2019) گزارش کردند که استرس های ایجاد شده در میتوکندری منجر به کاهش بیان TFAM در موش می شود(31). با توجه به این که این ژن در تمام فعالیت های DNA میتوکندریای نقش ایفا می کند و با توجه به این که میتوکندری در چرخه انرژی سلول نقش اساسی را دارد لذا تنش های ایجاد شده می تواند منجر به تغییر بیان ژن TFAM گردد. ژن NRF2 نقش مهمی در سم زدایی و رشد سلول دارد در نتیجه افزایش بیان این منجر به رشد طبیعی و متابولیسم عادی بافت کبد می گردد این ژن یک فاکتور رونویسی داخل سلولی که بیان بسیاری از ژن ها از جمله آنزیم ضد اکسیداتیو، عوامل سم زدایی، پروتئین های ضد آپوپتوزیس کنترل می کند(24). پسریکو و همکاران (2020) گزارش کردند که در شرایط استرس ژن NRF2 افزایش می یابد(22) در حالی که پاسینا و همکاران(2020) تفاوت معنی داری مشاهده نکردند(21). ژن SIRT3 در تنظیم مسیر سیگنالینگ میتوکندری باعث تنظیم انرژی تولیدی شده و نیاز جاندار برای رشد عادی را رفع می کند این ژن در شرایط تنش و استرس محیطی نقش برجسته ای را ایفا می کند میزان بیان این ژن در حیوانات دچار تنش شده بیش از دو برابر حیوانات تحت پرورش نرمال بود. چن و همکاران گزارش کردن که فعالیت ژن Sirt3 تحت استرس محیطی بیشتر می­شود و باعث سازگاری حیوان به شرایط پیش آمده می­گردد(8). با توجه به سازگاری ژنتیکی گوسفندهای بومی با شرایط آمیخته کردن نژاد بومی با نژادی بدون دستکاری ژنتیکی و خالص دارای بره زایی بالا مانند رومانوف گوسفندان مقرون به صرفه سازگار با شرایط محیطی تولید کرد. البته در طول تولیدگوسفندان آمیخته باید از ایجاد ژن های نامطلوب جلوگیری کرد

1.Alamer, M. (2010). Effect of water restriction on thermo regulation and some biochemical constituents in lactating Aardi goats during got weather conditions. Scientific Journal of King Faisal  University (Basic and Applied Sciences), 11; 189-205.
2.Anderson, R.M., Barger, J.L., Edwards, M.G., Braun, K.H., O'Connor, C.E., Prolla, T.A. (2008). Dynamic regulation of PGC-1alpha localization and turnover implicates mitochondrial adaptation in calorie restriction and the stress response. Aging Cell 7; 101–111.
3.Barbour, E., Rawda, N., Banat, G., jabber, l., Sleiman, F.T., Hamadeh, S. (2005). Comparison of immunosuppression in dry and lactating awassi ewes due to water deprivation stress. Veterinary Reserch Communication, 29; 47-60.
4.Bonawitz, N. D., Clayton, D. A., Shadel, G. S. (2006). Initiation and beyond: multiple functions of the human mitochondrial transcription machinery. Mol. Cell, 24; 813–825.
5.Burrin, D.G., Britton, R.A., Ferrell, C.L. (1988). Visceral organ size and hepatocyte metabolic activity in fed and fasted rats. J. Nutr., 118; 1547–1552.
6.Carling, D., Thornton, C., Woods, A. (2012). AMP-activated protein kinase: new regulation, new roles? Biochem. J., 445; 11–27. 
7.Chen, Y., Luo, H. Q., Sun, L. L., Xu, M. T., Yu, J., Liu, L. L. (2018). Dihydromyricetin attenuates myocardial hypertrophy induced by transverse aortic constriction via oxidative stress inhibition and SIRT3 pathway enhancement. International Journal of Molecular Sciences, 19(9); 2592.‏
8.Crispe, IN. (2009). The liver as a lymphoid organ. Annu Rev Immunol., 27; 147–63.
9.Drouillard, J.S., Ferrell, C.L., Klopfenstein, T.J., Britton, R.A. (1991). Compensatory growth following metabolizable protein or energy restrictions in beef steers. J. Anim. Sci., 69; 811–818.
10.Dumas, J.F., (2004). Food restriction affects energy metabolism in rat liver mitochondria. Biochim. Biophys. Acta, 1670; 126–131.
11.Dodson, M., de la Vega, MR., Cholanians, AB., Schmidlin, CJ, Chapman, E., Zhang, DD. ( 2019). "Modulating NRF2 in disease: timing is everything". Annual Review of Pharmacology and Toxicology., 59; 555–575.
12.Ekaterina, M., Myasnikova, M. M. (2011). Mechanisms of gap gene expression canalization in the Drosophila blastoderm. Article number:118 doi.org/10.1186/1752-0509-5-118.
13.Equils, O., Singh, S., Karaburun, S., Lu, D. (2005). Intra uterine growth restriction downregulates the hepatic toll like receptor-4 expression and function. Clin Dev Immunol., 12; 59–66.
14.Feng, Q., Shao, M., Han, J., Tang, T., Zhang, Y., Liu, F. (2020). TFAM, a potential oxidative stress biomarker used for monitoring environment pollutants in Musca domestica. International Journal of Biological Macromolecules, 155; 524-534.
15.Frisc, J.E., Vercoe, J. E. (1977). Food intake, eating rate, weight gains, metabolic rate and efficiency of feed utilization in Bos taurus and  Bos. Indicus Crossbred Cattle, 25(3); 343-358.
16.Guo-Min Z., Ting-Ting, Z. (2018). Effect of caloric restriction and subsequent re-alimentation on oxidative stress in the liver of Hu sheep. Ram Lambs., 237; 68–77.
17.Higgins, J.A. (2014). Resistant starch and energy balance: impact on weight loss and maintenance. Crit. Rev. Food Sci. Nutr., 54; 1158–1166.
18.Marai, I.F.M., El-Darawany, A.A., Fadiel A., Abdel-Hafez, M.A.M. (2007). Physiological traits as affected by heat stress in sheep—A review. Small Ruminant Research, 71;1–12.
19.Mehmet, T., Castro, T., Mantecon, A.R., Jimeno, V. (2006). Effects of palm oil and chemical body composition of lambs. Journal Animal Feed Science and Technology, 127; 175-186.
20.Mezzina, M., Reyes, A., D’Errico, I., Gadaleta, G. (2002). Characterization  of the TFAM gene and identification of a processed pseudogene in rat. Gen, 286; 105-112.
21.Pasini, A. F., Stranieri, C., Ferrari, M., Garbin, U., Cazzoletti, L., Mozzini, C. (2020). Oxidative stress and Nrf2 expression in peripheral blood mononuclear cells derived from COPD patients: an observational longitudinal study. Respiratory Research, 21(1); 37.
22.Peserico, D., Stranieri, C., Garbin, U., Mozzini C, C., Danese, E., Cominacini, L., Fratta Pasini, A. M. (2020). Ezetimibe prevents ischemia/reperfusion-induced oxidative stress and up-regulates Nrf2/ARE and UPR signaling pathways. Antioxidants, 9(4);349.
23.Picca, A., Fracasso, F., Pesce, V., Cantatore, P., Joseph, AM. (2012). Age- and calorie restriction-related changes in rat brain mitochondrial DNA and TFAM binding. Dordr: AGE., . doi:10.1007/s11357-012-9465-z Sep 4 .
24.Sajadimajd, S., Khazaei, M. (2018). Oxidative stress and cancer: the role of Nrf2. Current cancer Drug Targets, 18(6); 538-557.
25.Silanikove, N. (1994). The struggle to maintain hydration and  osmoregulation in animals experiencing severe dehydration and rapid rehydration: the story of ruminants. Exp. Physiol. 79; 381-400.
26.Silanikove, N. (2000). The physiological basis of adaptation of goats to  scarcity of food and water in harsh environments Small Rumin. Res., 35; 181–193.
27.Sun, Q., Yang, Y., Wang, Z., Yang, X., Gao, Y., Zhao, Y. (2020). PER1 interaction with GPX1 regulates metabolic homeostasis under oxidative stress. Redox biology, 37;101694.
28.Van Remmen, H., Sabia, Qi, W., Freeman, M., Estlack, G., Yang, L., Mao Guo, H. (2004). Multiple deficiencies in antioxidant enzymes in mice result in a compound increase in sensitivity to oxidative stress. Free Radic. Biol. Med., 36; 1625–1634.
29.Vitaly, V., Gursky, L. P. (2011). Mechanisms of gap gene expression canalization in the Drosophila blastoderm. Gursky. BMC Systems Biology, 5; 118,
30.Wigner, P., Synowiec, E., Jóźwiak, P., Czarny, P., Bijak, M., Białek, K. (2021). The Effect of chronic mild stress and escitalopram on the expression and methylation levels of genes involved in the oxidative and nitrosative stresses as well as tryptophan catabolites pathway in the blood and brain structures. International Journal of Molecular Sciences, 22(1); 10.
31.Wu, Z., Oeck, S., West, A. P., Mangalhara, K.C., Sainz, A. G., Newman, L. E. (2019). Mitochondrial DNA stress signalling protects the nuclear genome. Nature Metabolism, 1(12); 1209-1218.