جداسازی و غربالگری باکتریوفاژهای دریایی به منظور کاربرد در پیشگیری از بروز بیماری ویبریوزیس در میگوی سفید غربی

نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه میکروب شناسی، دانشکده علوم، کشاورزی و فناوری‌های نوین، واحد شیراز، دانشگاه آزاد اسلامی، شیراز

2 مؤسسه تحقیقات علوم شیلاتی کشور، سازمان تحقیقات، آموزش و ترویج کشاورزی، تهران، ایران

3 پژوهشکده میگوی کشور، موسسه تحقیقات علوم شیلاتی کشور، سازمان تحقیقات، آموزش و ترویج کشاورزی، بوشهر، ایران

چکیده

زمینه و هدف: یکی از بزرگ ترین تهدیداتی که صنعت آبزی‌پروری با آن مواجه است، بیماری‌های عفونی باکتریایی و استفاده از آنتی بیوتیک ها است. فاژدرمانی یک جایگزین قابل اعتماد برای آنتی‌بیوتیک‌ها برای غیرفعال‌کردن باکتری به‌ عنوان عوامل اصلی بیماری‌زا در صنعت آبزی‌پروری می باشد. هدف از تحقیق حاضر غربالگری گونه های ویبریو در سواحل استان بوشهر و کنترل این عامل بیماری زای میگو با استفاده از فاژ بود.
روش کار: جهت انجام این مطالعه آب در سال 1398 و از مناطق نزدیک به سواحل استان بوشهر نمونه برداری شد. باکتری های عامل ویبریوزیس با استفاده از آزمایش های بیوشیمیایی و توالی یابی مولکولی تعیین شد. انتخاب باکتری هدف با توجه به نتایج پروفایل آنتی بیوگرام باکتری های غالب و پاتوژن ها انجام گردید. جهت تعیین تیتر فاژ محیط کشت TCBS به کار برده شد و شمارش پلاگ­ها 24 ساعت پس از گرمخانه گذاری در دمای 30 درجه سانتی گراد انجام گرفت.
یافته­ها: از آب های آلوده به فاضلاب بوشهر، 5 باکتری(Vibrio alginolyticus strain SeqID، Vibrio xuii strain Z-03Phage، Vibrio alginolyticus SZ/10 gene، Vibrio rotiferianus strain SRPR-Phage، Vibrio harveyi strain Z05) جداسازی شد. با توجه به نتایج تعیین پروفایل آنتی بیوگرام، قطر هاله ی عدم رشد و آزمون بیوشیمایی باکتری گونه های مورد مطالعه، باکتری Vibrio alginolyticus strain SeqID به عنوان گونه ی باکتری غالب انتخاب شد. بر اساس نتایج حاصل از آنالیز مولکولی 16srDNA سویه جداسازی شده باکتری با 100% شباهت با باکتری ویبریو آلجینولایتیکوس بود، براساس نتایج دامنه میزبانی، فاژ Vibrio alginolyticus strain Samira Phage قادر به تشکیل پلاگ بود.
 نتیجه گیری: باکتریوفاژ Vibrio alginolyticus strain Samira Phage جداسازی شده اثر باکتری کشی با دامنه ای وسیع در برابر باکتری های ویبریوی شناسایی شده از سواحل بوشهر داشت که نشان می دهد این باکتریوفاژ می تواند کاندیدی مناسبی برای استفاده در فاژ درمانی بر علیه بیماری ویبریوز باشد.

کلیدواژه‌ها


عنوان مقاله [English]

Isolation and screening of marine bacteriophages for use in the prevention of Vibriosis in Western white shrimp

نویسندگان [English]

  • Samira Zarei 1
  • Nima bahador 1
  • maryam Mirbakhsh 2
  • Mohammad Khalil pazir 3
1 Department of Microbiology, College of Science, Shiraz Branch, Islamic University, Shiraz, Iran
2 Iranian Fisheries Science Research Institute, Agricultural Research Education and Extension Organization (AREEO), Tehran, Iran
3 Iranian Shrimp Research Center, Iranian Fisheries Science Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Bushehr, Iran.
چکیده [English]

The aim of this study was to screen Vibrio species off the coast of Bushehr province and control this shrimp pathogen using phage.
For this study, water was sampled in 1398 from areas close to the coast of Bushehr province. Bacteria that cause Vibriosis were determined using biochemical tests and molecular sequencing. Bacterial selection was performed according to the results of antibiogram profiles of dominant bacteria and pathogens. TCBS was used to determine the phage titer of the culture medium and the plugs were counted 24 hours after incubation at 30 ° C.
5 bacteria (Vibrio alginolyticus strain SeqID, Vibrio xuii strain Z-03Phage, Vibrio alginolyticus SZ / 10 gene, Vibrio rotiferianus strain SRPR-Phage, Vibrio harveyi strain Z05 were isolated from Bushehr wastewater contaminated waters). Vibrio alginolyticus strain SeqID was selected as the dominant bacterial species according to the results of antibiogram profile determination, growth halo diameter and bacterial biochemical test of the studied species. Based on the results of 16srDNA molecular analysis, the isolated strain of the bacterium was 100% similar to Vibrio alginolyticus. Based on the results of the host domain, Vibrio alginolyticus strain Samira Phage was able to form plugs.
The isolated bacteriophage Vibrio alginolyticus strain Samira Phage had a bactericidal effect with a wide range against Vibrio bacteria identified from the shores of Bushehr, which indicates that this bacteriophage can be a good candidate for use in phage therapy Be against viberosis.
Keywords: Isolation and screening, Bacteriophage, Vibriosis, Western white shrimp

کلیدواژه‌ها [English]

  • Isolation and screening
  • Bacteriophage
  • Vibriosis
  • Western white shrimp

مقدمه

 

پرورش آبزیان یکی از سریع الرشدترین صنایع تولید مواد غذایی می باشد و پروش میگو با رشد سالانه 8/16 درصد از جمله این صنایع می باشد(12). بر اساس آمار ارائه شده زیان های اقتصادی ناشی از بیماری های میگو در جهان حدود 3 میلیارد دلار آمریکا می باشد. عوامل بیماری زای آبزیان از جمله عواملی هستند که می‌توانند صنعت آبزی پروری را مورد تهدید قرار داده و باعث کاهش تولید در واحد سطح شوند(33). از بین غذاهای دریایی میگو یکی از غذاهای دریایی محبوب می باشد که توسط مردم از فرهنگ ها و کشورهای مختلف مورد مصرف قرار می گیرد(7). امروزه در مزارع آبزی پروری، عوامل ضد میکروبی اضافه شده به غذا و آب نه تنها برای درمان بیماری ها به کار می رود بلکه برای جلوگیری از بیماری هایی است که میگوها را تحت تاثیر قرار می دهند(37). به منظور کنترل پاتوژن های باکتریایی میگو، آنتی بیوتیک ها به طور گسترده مورد استفاده قرار می­گیرند(36). مشکلی که مصرف آنتی بیوتیک ها دارد این است که باکتری های مقاوم به داروهای ضد میکروبی میگوها را آلوده می کنند و زمانی که میگوهای آلوده مصرف شوند این باکتری های مقاوم و عفونت های ناشی از آن نیز به انسان منتقل می شود(2). صادرات و واردات غذاهای دریایی نیز موجب انتقال باکتری های مقاوم به مواد ضد میکروبی بین کشورها می شود(1). ویبریوزیس یکی از بیماری‌های مهم منجر به مشکلات در صنعت آبزی پروری می‌باشد. این عفونت باکتریایی باعث مرگ ‌و میر قابل توجهی در ماهیان می‌شود به‌طوری که در مراکز آلوده به عفونت تا 100% مرگ‌ و میر می‌رسد و مسئول بسیاری از طیغان‌های بیماری‌ اخیر در مزارع پرورش ماهی است(30). بیماری ویبریوز ناشی از گونه‌هایی از جنس‌های ویبریو شامل: ویبریو آنگوئیلاروم، ویبریو ولنیفیکوس، ویبریو آلجینولایتیکوس، ویبریو پاراهمولایتیکوس و ویبریو سالمونیسیدا است و بیماری فوتوباکتریوز ناشی از جنس فوتو باکتریوم است(31). بیماری ویبریوزیس بسیاری از پرورش‌دهندگان را وادار می‌کند که از مقادیر بیش از حد آنتی‌بیوتیک استفاده نمایند(10)، به امید این که از اپیدمی باکتریایی جلوگیری کنند. تعداد زیادی از آنتی بیوتیک ها به شکل بالینی برای درمان عفونت های ناشی از گونه های ویبریو استفاده می شوند(40)، این آنتی بیوتیک ها عبارتند از سفالوتین(از سفالوسپورین های نسل اول)، سفورکسیم(از سفالوسپورین های نسل دوم)، سفوتاکسیم و سفتازیدیم (سفالوسپورین های نسل سوم)، تتراسایکلین، داکسی سایکلین و فلوئوروکینولون(41). مقاومت آنتی بیوتیک جدایه های گونه ویبریو در موجودات دریایی در سراسر جهان گزارش شده است. تحقیقات متعددی در زمینه مقاومت به آنتی بیوتیک در گونه های ویبریو در حیوانات مختلف دریایی کشورهای توسعه یافته انجام شده است(38). علاوه بر این، هیچ یک از داروهای پزشکی جهانی که توسط اداره غذا و داروی توصیه می شود برای درمان میگو در آبزی پرورش در برابر عفونت گونه ویبریو تاثیر گذار نبوده است(28)؛ مطالعۀ فاژ درمانی، راهکاری جالب و جذاب برای اتخاذ در صنعت میگو، به خصوص با توجه به مفهوم زیست‌محیطی سبز است(26). باکتریوفاژها ویروس‌هایی که باکتری‌ها را آلوده می‌کنند. فاژها همه جا موجود هستند و به یک میزبان باکتریایی نیاز دارند. آن‌ها هم چنین فراوان‌ترین ارگانیسم‌هایی هستند که در بیوسفر یافت می‌شوند(21). فاژدرمانی مزیت‌های بیشتری نسبت به درمان آنتی‌بیوتیکی مرسوم دارد(5). جداسازی فاژها، سریع، نسبتاً آسان و کم‌هزینه است. مقاومت به فاژها حدوداً 10 مرتبه کندتر از مقاومت آنتی‌بیوتیکی گسترش می‌یابد(17) فاژها تحت شرایط محیطی بسیار سخت عفونی باقی می‌مانند و تمایل دارند همانندسازی را تا زمانی که تراکم جامعۀ میزبان باکتریایی به طرز معناداری کاهش می‌یابد ادامه دهند(9). اغلب فاژهایی که تا به امروز جداسازی شده‌اند، سطح اختصاصیت(ویژگی) نسبتاً بالایی برای میزبان خود دارند. این مزیت فاژها، ریسک(خطر) آسیب رساندن به میکروبیوتای طبیعی بدن انسان را کاهش می‌دهد(42).

مواد و روش ها

در این پژوهش برای تعیین باکتری های غالب نمونه­گیری از نقاط ورودی فاضلاب تصفیه شده به سواحل خلیج فارس بوشهر انجام گرفت. نمونه گیری ها در فصل بهار، خرداد ماه 1398 به روش غوطه‌وری(32) با برداشتن 750 میلی لیتر آب در ظروف از پیش استریل در ساعات 7:00 صبح و 12:00 ظهر(زمان مد دریا) فصل بهار(خرداد ماه) انجام شد. نمونه ها از مناطق نزدیک به ساحل واقع در مناطق شغاب، جفره و آب شیرین کن تهیه و تحت شرایط استریل به آزمایشگاه میکروبیولوژی پژوهشکده میگوی کشور انتقال داده شدند. از نمونه های حاصل رقت هایی از 1 - 10 تا 6 - 10 در محلول نمکی 5/2 درصد استریل یا آب دریای استریل تهیه شد(6) و با رعایت شرایط استریل روی پلیت حاوی محیط کشت تیوسولفات سیترات نمک صفراوی ساکارز آگار ریخته و روی سطح محیط پخش و پس از جذب نمونه تلقیحی پلیت ها در انکوباتور با دمای 30 درجه سانتی‌گراد به مدت 24 ساعت انکوبه و سپس تعداد کلنی ها شمارش و ثبت شد. کلونی هایی که از نظر تعداد غالب بودند برداشته شده و توسط کشت خطی در محیط کشت تریپتیک سوی آگار خالص سازی آن ها صورت گرفت(21). بعد از انجام آزمایش های بیوشیمیایی رایج نمونه ها به کمک کیت تشخیصی API 20e مورد شناسایی تائیدی قرار گرفتند. شناسایی مولکولی جدایه ها با استخراج DNA ژنومیک باکتری های گرم منفی با استفاده از روش جوشاندن انجام گرفت. و بررسی کمی و کیفی DNA ژنومی استخراجی به روش الکتروفورز روی ژل آگارز انجام شد. پرایمر های مورد استفاده به ترتیب V1F با توالی پرایمری جدول زیر بود(18). توالی یابی نمونه ها توسط شرکتGATC-Biotech و به وسیله دستگاه 3730xl و تکنولوژی SANGER صورت گرفت. مقایسه توالی های به دست آمده با توالی های ثبت شده در بانک جهانی ژن(NCBI) و ایزوتاکسون و توسط نرم افزار BLAST صورت گرفت. به منظور تعیین پروفایل مقاومت آنتی بیوتیکی، از دیسک­های آنتی بیوتیک جنتاماسین(50 میکروگرم)، کلرامفنیکل(30 میکروگرم)، کوتریموکسازول(50 میکروگرم)، تتراسایکلین(30 میکروگرم)، نئوماسین(30 میکروگرم در هر دیسک) استفاده شد. تعیین پروفایل آنتی بیوگرام به روش توصیه شده CLSI 2018 که روش Kirby-Bauer بود و روی محیط کشت مولرهینتون آگار انجام شد(8). کلیه آزمون های آنتی بیوگرام طی سه تکرار مورد آزمایش قرار گرفت و نتایج به کمک آزمون های آماری مورد آنالیز قرار گرفت. فاژ از نمونه آب های آلوده به فاضلاب سواحل خلیج فارس در مناطق شغاب، آب شیرین کن و سواحل جفره در استان بوشهر جدا سازی شد. جهت جدا سازی فاژ ابتدا 50 میلی‌لیتر از آب آلوده به فاضلاب به همراه 50 میلی لیتر محیط باکتریوفاژ براث و 1 میلی لیتر از کشت شبانه از سویه های باکتری جداسازی شده از مناطق مذکور به مدت 24 ساعت در دمای 30 درجه سانتی گراد در گرمخانه نگهداری شد. پس از یک شبانه روز گرمخانه گذاری محتویات آماده شده از فیلتر کاغذی عبور داشته شد و با دور 20000 به مدت 10 دقیقه سانتریفیوژ شد(13). بعد از این مرحله مایع سوپرناتانت رویی از فیلتر سر سرنگی 45/0 عبور داده و در مرحله بعد 1/0 میکرولیتر از کشت شبانه باکتری و 1/0 ماکرولیتر از فیلترات رو در مرکز پلیت تیوسولفات سیترات نمک صفراوی ساکارز آگار ریخته و به صورت گسترده کشت و در دماهای 4، 25 و 30 درجه نگهداری شد. حضور فاژ طی بازه های زمانی یک ساعت مورد ارزیابی جهت حضور پلاگ قرار گرفت(43). برای شناسایی فاژ ابتدا دامنه میزبانی فاژ بررسی شد به این صورت که باکتری‌های جداسازی شده همراه با ارگانیزم های مهم گرم مثبت و منفی(استرپتوکوکوس و اشریشیا کلی) به عنوان شاخص‌هایی برای بررسی دامنه میزبانی فاژ با بررسی تعداد پلاگ های تشکیل شده مورد بررسی قرار گرفتند(13). سپس مخلوط باکتری و فاژ در مرکز محیط کشت تیوسولفات سیترات نمک صفراوی ساکارز آگار ریخته شد و با میله شیشه ای استریل به صورت گسترده کشت و در انکوباتور 32 درجه ی سانتی گراد به مدت 24 ساعت نگه داشته شد(35). جهت بررسی شکل و ابعاد فاژ از میکروسکوپ الکترونی استفاده و جهت تشخیص نوع فاژ از نظر لایتیک و یا لایزوژن بودن آن ابتدا 100 میکرولیتر از نمونه فاژ خالص شده به 100 میکرولیتر از نمونه باکتری افزوده، مجموعه مجدداً به محیط کشت TCBS منتقل نموده و پس از انکوباسیون در دمای 35 درجه سانتی گراد در بازه های زمانی یک ساعت جهت حضور پلاگ مورد ارزیابی قرار گرفت(43). در این مرحله پلاگ های شفاف به عنوان فاژهای لایتیک و پلاگ های کدر با حاشیه مضررس به عنوان فاژهای لایزوژنیک مد نظر قرار گرفته شد(35). آزمایش های مولکولی بعد از جداسازی DNA فاژ PCR با استفاده از پرایمرهای جدول2 انجام گرفت(34). جهت تجزیه و تحلیل داده ها با استفاده از آنالیز واریانس یک طرفه و تست تکمیلی دانکن توسط نرم افزار Spss23 انجام شد.

نتایج

با توجه نتایج حاصل از تهیه گسترش رنگ آمیزی شده به روش گرم و آزمایشات بیوشیمیایی با استفاده از کیت API 20 e، گونه باکتریایی انتخاب شده، ویبریو آلجینولایتیکوس شناسایی گردید(جدول 3 و شکل 1). آزمایش های مولکولی، نتایج به دست آمده در مرحله بیوشیمیایی را تایید کرد و نشان داد که جدایه های باکتری به دست آمده تنها از منطقه شغاب بوده است که در زیر لیست این جدایه ها با شماره ثبت شده در GenBank در جدول 4 آورده شده است.

 

 

جدول 1- پرایمرهای مورد استفاده برای شناسای باکتری ها

TGGAGAGTTTGATCCTGGCTC

V1R

AGGAGGTGATCCAACCGCA

ABI

 

جدول 2- پرایمرهای مورد استفاده برای شناسای باکتریوفاژها

GTGACCTTGAGAACCGTATGC

فروارد

GGTAGCCGTTAGCGTTAG

ریورس

 

جدول 3-نتایج آزمون های بیوشیمیایی باکتری ویبریو آلجینولایتیکوس با استفاده از کیت API 20e

تست

 

ONPG

ADH

LDC

ODC

URE

TDA

GEL

ARA

SOR

RHA

IND

MEL

AMY

SAC

INO

H2S

VP

GLU

MAN

CIT

نتایج

-

-

+

-

-

-

+

-

+

-

+

-

+

+

+

-

+

+

+

+

 

 

 

 

 

 

شکل 1- نتایج کیت API20E


نتایج به دست آمده حاکی از این بود که گونه های مورد مطالعه نسبت به آنتی بیوتیک های کلرامفنیکل، تتراسایکلین و جنتامایسین و نئومایسین مقاومت داشتند(جدول 5). بالاترین قطر هاله ی عدم رشد هر 5 باکتری در برابر کلرامفنیکل بود(05/0≥p). کمترین قطر هاله عدم رشد در مورد باکتری های Vibrio xuii، Vibrio alginolyticus SZ/10، Vibrio harveyi و Vibrio alginolyticus strain SeqID-10 در برابر فرازولیدون و در مورد باکتری Vibrio rotiferianus در برابر اریترومایسین بود (05/0 ≥ P). با توجه فراوانی ایزوله­های جداسازی شده و با توجه به نتایج تعیین پروفایل آنتی بیوگرام و قطر هاله ی عدم رشد گونه های مورد مطالعه، باکتری (MK641453.1) Vibrio alginolyticus به عنوان گونه ی باکتری غالب انتخاب شد. بر اساس نتایج حاصل از آنالیز مولکولی 16srDNA سویه جداسازی شده با استفاده از نرم افزار بلاست و EZ taxon، این باکتری متعلق به شاخه گاما پروتوباکتریا، خانواده ویبریوناسه و جنس ویبریو با 100% شباهت با باکتری ویبریو آلجینولایتیکوس بود، لذا نتایج حاصل از نرم افزار با نام سویه seqID-10 در بانک جهانی ژن به ثبت رسید. در شکل 3، فاژهای جدا شده از نمونه آب های آلوده به فاضلاب سواحل خلیج فارس در مناطق شغاب، آب شیرین کن و سواحل جفره در استان بوشهر نشان داده شده است. بیشترین تعداد پلاگ با pf بررسی دامنه میزبانی فاژ Vibrio alginolyticus strain Samira Phage و نتایج حاصل از شمارش پلاگ ها در میزبان های فاژ جدا سازی شده در شکل 4 نشان داده شده است. بر این اساس Vibrio alginolyticus strain Samira Phage با تشکیل 69 پلاگ در باکتری Vibrio harveyi بیشترین اثر و 23 پلاگ در باکتری Vibrio rotiferianus کمترین اثر را داشت (05/0≥p). دامنه میزبانی فاژ بین دو گروه باکتری Vibrio alginolyticus SZ/10 و Vibrio rotiferianus اختلاف معنی داری نداشت(05/0<P)(جدول 6).u/ml 80/53 در رقت 5-10 و کمترین تعداد پلاگ در رقت 9-10 با مقدار pfu/ml 5/54 اندازه گیری شد(شکل 4). خصوصیات مورفولوژیکی فاژVibrio alginolyticus strain Samira Phage با استفاده از میکروسکوپ الکترونی عبوری(TEM) نشان داد که این فاژ یک بیست‌وجهی(قطر 60 نانومتر) با یک دم غیرقابل انقباض می باشد. هیچ زائده یقه‌ای یا دمی مشاهده نشد(شکل 5). بر اساس نتایج حاصل از آنالیز مولکولی و نیز ترتیب گذاری سنجر ومشاهده خصوصیات مورفولوژی فاژ نشان داده شد که Vibrio alginolyticus strain Samira Phage جداسازی شده از باکتری strain SeqID (MN559533.1)Vibrio alginolyticus با داشتن ساختار 8 ضلعی و دم کوتاه متعلق به خانواده پودو ویریده فاژ می­باشند. نتایج حاصل از نرم افزار Neighbor joining با نام سویه Samira Phage و شماره MN559533.1 در بانک جهانی ژن به ثبت رسید و توالی نوکلئوتیدی آن به صورت زیر مشخص گردید (شکل 6).

 

 

جدول 4- باکتری های شناسایی شده

شماره ثبت شده

نام باکتری

ردیف

MK641453.1

Vibrio alginolyticus strain

1

MN559963.1

Vibrio xuii strain Z-03Phage

2

LC468037.1

Vibrio alginolyticus SZ/10

3

MN559967.1

Vibrio rotiferianus strain SRPR-Phage

4

MN559362.1

Vibrio harveyi strain Z05 16S

5

 

 

شکل 2- نتایج محصولات PCR حاصل از تکثیر نمونه‌های مختلف باکتری

 

جدول 5- قطر هاله عدم رشد (میانگین±میانگین انحراف معیار) باکتری­های منتخب در مواجهه با آنتی بیوتیک

آنتی بیوتیک

 

باکتری

قطر هاله عدم رشد باکتری در حضور آنتی بیوتیک (میلی­متر)

جنتامایسین

کلرامفنیکل

نئومایسین

تتراسایکلین

اریترومایسین

فرازولیدون

Vibrio xuii

c 09/0 ± 92/2

f 08/0 ± 02/9

b 15/0 ± 49/1

d 05/0 ± 38/3

e 06/0 ± 77/4

a 02/0 ± 41/0

Vibrio alginolyticus SZ/10

c 10/0 ± 45/2

e 04/0 ± 83/7

b 02/0 ± 85/1

b 06/0 ± 94/1

d 09/0 ± 83/4

a 03/0 ± 18/1

Vibrio harveyi

c 12/0 ± 49/2

e 36/0 ± 40/9

b 02/0 ± 91/1

ab 02/0 ± 78/1

d 09/0 ± 86/4

a 09/0 ± 3/1

Vibrio rotiferianus

e 10/0 ± 35/4

f 06/0 ± 25/7

d 07/0 ± 15/3

b 04/0 ± 77/0

a 02/0 ± 44/0

c02/0 ± 03/1

Vibrio alginolyticus strain SeqID-10

d 05/0 ± 19/4

f 07/0 ± 56/10

c 35/0 ± 90/2

b 05/0 ± 83/1

e 31/0 ± 58/5

a 06/0 ± 82/0

حروف غیر مشابه نشان دهنده ی اختلاف معنی دار در ردیف است(05/0P<).

 

 

 

 

 

 

 

شکل 3- فاژ جداسازی شده در محیط TCBS

(پلاک ها تشکیل شده در با علامت فلش مشخص شده است)

 

 

 

شکل 4- پلاگ های تشکیل شده در تعیین تیتر فاژ

(پلاک ها تشکیل شده در با علامت فلش مشخص شده است)

 

جدول 6- تعیین تیتر Vibrio alginolyticus strain Samira Phage و تعداد پلاگ های مشاهده شده (pfu/ml)

9- 10

8- 10

7- 10

6- 10

5- 10

رقت باکتری

54/5±91/0 a

33/ 13 ±76/1 b

16/31±68/1 c

70/48±01/2 d

80/53±22/1 e

Vibrio alginolyticus strain Samira Phage

حروف غیر مشابه نشان دهنده­ی اختلاف معنی­دار در ردیف است (05/0P<).

 

 

 

شکل 5- پلاگ­های تشکیل شده در محیط کشت TCBS در مواجه فاژ با باکتری­های میزبان (پلاک های تشکیل شده توسط فاژ).

 

 

 

شکل 6- میکروگراف فاژ PW2 تهیه شده با میکروسکوپ الکترونی Vibrio alginolyticus strain Samira Phage با میکروسکوپ الکترونی TEM

 

شکل 7- محصولات PCR حاصل از تکثیرژن کپسولی فاژ

شماره 1 Ladder، شماره 2 کنترل منفی، شماره 3 نمونه فاژ جدا شده

 

بحث ونتیجه گیری

امروزه باکتری های مقاوم به دارو و نیز باقی مانده های آنتی بیوتیکی به یکی از مشکلات و دغدغه های جهانی تبدیل شده است که توجه و شناسایی روش های درمانی جایگزین برای پاتوژن های باکتریایی را به ضرورت تبدیل می کند که در این میان فاژها به دلیل پتانسیل بالا در تخریب باکتری بسیار مورد توجه قرار گرفتند(26). مطالعه­ی حاضر به منظور استفاده از عوامل طبیعی(باکتریوفاژها) جهت مقابله با بیماری همه گیر ویبریوزیس در میگو انجام شده است. باکتری های جدا شده از سواحل آلوده استان بوشهر Vibrio alginolyticus، V. rotiferianus، V. xuii و V. harveyi بودند. در طرح تحقیقاتی موسسه تحقیقات علوم شیلات 40 ایزوله باکتری جداسازی شد که 8 ایزوله با توالی srDNA 16 بیشترین توالی را داشتند که شامل Vibrio nigripulchritudo، Vibrio brasiliensis، Vibrio  بود(23). Phumkhachorn و Rattananchaikunsopon (2010)، گونه ی V. harveyi را به عنوان گونهی غالب ویبریوز در تایلند معرفی کردند. هم چنین در مطالعات مختلف گونه هایی مانند Vibrio harveyi، Vibrio parahaemolyticus و Vibrio campbelli به عنوان عوامل سببی بروز بیماری ویبریوز لومینوس در مزارع پرورش میگو شناخته شده اند(19). در مطالعه ی Jun و همکاران (2014) در آب‌های سطحی دریای زرد در کره(11) و Onarinde و همکاران (2018) در آب های مصب Humber در انگلستان، باکتری Vibrio parahaemolyticus را به عنوان عامل ویبریوز جدا کردند که با نوع غالب ویبریو مطالعه ی حاضر هم خوانی دارد(24). فاژ مورد بررسی در این مطالعه از باکتری ویبریو آلجینولایتیکوس جدا گردید و تحت عنوان Vibrio alginolyticus strain Samira Phage نام گذاری گردید. ساختار فاژ مطالعه ی حاضر 8 ضلعی با قطر 60 نانومتر و دم کوتاه و غیر قابل انقباض که هیچ زائده یقه ای یا دمی نداشت توصیف کرد. در مطالعه ی Phumkhachorn و Rattanachaikunsopon (2010) باکتریوفاژ جدا شده از باکتری Vibrio harveyi بیست وجهی و با قطر 50 نانومتر که یک دم غیر قابل انقباض و بدون هیج زائده یقه ای بود(25). در مطالعه ی Matsuzaki و همکاران(1992)، باکتریوفاژ KVP40 به عنوان ویبریوفاژ از V. parahaemolytcius(22) و در مطالعه ی Kalatzis و همکاران(2016) دو باکتریوفاژ φSt2 و φGrn1 از باکتری V. alginolyticus جدا شدند(14). نتایج مطالعه ی حاضر نشان داد و فاژ Vibrio alginolyticus strain Samira Phage توانای مواجه با سایر باکتری های شناسایی شده(A,B,E و P) را داشت. فاژها با اتصال به دیواره سلولی باکتری و لیزکردن آن سبب مرگ باکتری می شوند که با توجه به منشا طبیعی این فاژها، می توان عنوان کرد که استفاده از باکتریوفاژ برای کنترل بیولوژیکی بیماری های ماهیان پرورشی، گزینه مناسبی خواهد بود(44) زیرا مطالعات سال های پیش نظیر Karunasagar و همکاران(2007) نشان می­دهد که آنتی بیوتیک های مورد استفاده در هچری، در کنترل باکتری های V. harveyi بی تاثیر بودند زیرا باکتری های V. harveyi مقاوم به آنتی بیوتیک در مخازن لارو پدیدار شدند(15).  Vibrio cholera جداشده از نمونه های بالینی در ایران نسبت به اریترومایسین، سولفامتوکسازول تری متوپریم و آمپی سیلین، مقاوم است(29). هم چنین مطالعات جداسازی سویه های دارای مقاومت چندگانه دارویی باکتری Vibrio از نمونه های بالینی و محیطی را گزارش کرده‌اند(44، 34، 25). علاوه براین استفاده از باکتریوفاژها به منظور کنترل پاتوژن ها در سیستم های آبی، به دلیل مسائل مرتبط با بقایای دارویی و سمیت و ممنوعیت های متعاقب توسط کشورهای واردکننده، از اهمیت زیادی برخوردار هستند(17، 15، 14، 11). فاژها از محیط هایی جدا می شوند که زیستگاه هایی برای باکتری­های میزبان مخصوص آن ها هستند که این موضوع اختلاف معنی دار بین تعداد پلاگ ها در باکتری های مختلف در مواجه با فاژ Q را توجیه می کند (05/0P ≥). از دیگر دلایل تفاوت در قدرت ضدباکتری فاژها را می­تواند به مکانیسم های ضدفاژی در گروه های مختلف باکتری مربوط دانست از جمله سیستم ایمنی تحت عنوان توالی های تکراری پالیندرومی کوتاه خوشه‌ای با فاصلۀ منظم(CRISPR) و توالی‌های وابسته به(CRISPR (cas اشاره کرد که به باکتری امکان می دهد که نسبت به برخی عناصر ژنتیکی متحرک،، شامل فاژها و پلاسمیدها، مقاوم باشند و با آن‌ها مقابله کنند(26،32) که تفاوت در تعداد پلاگ ایجاد شده در مطالعه ی حاضر را توجیه می کند. در مطالعه vinod و همکاران (2006) فاژ جدا شده از باکتری V. harveyi محیط های تفریخ گاهی تخم را، در مقابل V. cholerae، V. parahaemolyticus، V. alginolyticus و V. vulnificus که در آب ساحلی مورد آزمایش قرار دادند و نتایج نشان داد که این فاژ برای V.harveyi استخرهای پرورشی اختصاصی عمل می­کند و در برابر سایر باکتری ها کارآمد نبود(39).Letchumanan  و همکاران (2016)، باکتریوفاژ آلوده‌کننده باکتری Vibrio harveyi جدا شده از آب حوضچه ی پرورش میگو، تمام سویه‌های V. harveyi را آلوده کرد اما در مورد سایر جنس های باکتریایی و یا سویه‌های Vibrio بی اثر بودند که هر دو مطالعه با یافته­های مطالعه­ی حاضر هم­خوانی ندارد(16). موفقیت فاژتراپی به عوامل مختلفی از جمله بقای فاز و هم چنین تعداد فاژ موجود در محیط وابسته است(27). نتابج نشان دادند با افزایش رقت ویبریو آلجینولایتیکوس فاژ تعداد پلاگ ها به شکل معنی داری کاهش یافت به شکلی که در رقت 5-10، تعداد پلاگ ها pfu/ml 22/1±80/53 و در رقت 9-10 تعداد پلاگ ها pfu/ml91/0±54/5 بود(05/0≥p  ). Silva و همکاران(2014) افزایش رقت فاژ VP-2 را عامل تخریب بالاتر باکتری V. anguillarum ذکر کردند. در غلظت های بالاتر، تعداد فاژهایی که در میزبان باکتری وارد می شود افزایش می­یابد و این امر هم بر روی سرعت و هم قدرت تخریب می­افزاید.فعالیت فاژ بستگی به پارامترهای محیطی دارد و تغییرات در این پارامترها تاثیرات مثبت و منفی بر روی فعالیت این عوامل ضدباکتریایی دارد. در زمان کاهش تیترهای فاژ تحت تاثیر عوامل محیطی، استفاده از غلظت­های بیشتر فاژ را به منظور حذف باکتری ضروری است و این امر شناسایی شرایط بهینه برای عملکرد فاژها را مشخص می سازد(20). در مطالعه ی حاضر بیشترین تعداد پلاگ در pH 6، 7 و 8 که(pH آب دریا) و کم­ترین تعداد پلاگ در pH برابر با 4 و 5 و 10 و 11(خارج از محدوده­ی طبیعی دریا)، شمارش شد. هم چنین نتایج نشان داد فعالیت فاژ وابسته به دما بود به شکلی که با افزایش دما تعداد پلاگ ها به شکل معنی داری کاهش یافت (05/0≥ P) و در دمای 25 و 60 درجه ی سانتی گراد به ترتیب بیشترین و کم ترین تعداد پلاگ ها شمارش کرد که بیان گر محیطی بودن فاژ و دامنه تحمل دمای آب دریا می باشد. در مطالعه ی جداسازی و بررسی جزئی خصوصیات باکتریوفاژ آلوده‌کننده Vibrio harveyi از پاتوژن‌های میگو توسط Phumkhachorn و Rattananchaikunsopon (2010)، پایداری فاژ را وابسته به دما و pH عنوان کردند و با افزایش دما از 50 تا 90 درجه باکتریوفاژ غیرفعال شد و در مورد pH فاژ در محدوده pH بین 4 تا 10 انکوبه شد، توانایی عفونت‌زایی خود را حفظ کرد . با این حال، در pH 2، 3 و 11 فاژ تشخیص داده نشد (19). همچنین در مطالعه‌ی Benyajirapatch و Rengpipat (2014)، بقای پنج باکتریوفاژ VC1، VC2، VC3، VC4 و VC5 جدا شده از سویه‌های ویبریو کلرا، ویبریو پاراهمولیتیکوس، ویبریو آلجینولایتیکوس، ویبریو وولنیفیکوس و ویبریو فلاویوالیس، در محدوده pH 6 تا 10 و دمای 60-20 درجه سانتی گراد بود که هر دو مطالعه با یافته های پژوهش حاضر هم خوانی دارد(3). Choudhury و همکاران (2012)، نیز عوامل محیطی را به سبب غیر فعال کردن فاژ بر روی تعداد موثر باکتریوفاژها موثر دانستند(4). در مطالعه ی آن ها دمای 30 درجه‌ی سانتی‌گراد به عنوان دمای بهینه برای فعالیت فاژ V در برابر باکتری Vibrio harveyi ذکر شده است. گونه های ویبریو باکتری های میله‌ای شکل خمیده گرم منفی هستند که به خانواده Vibronaceae تعلق دارند. این باکتری ها به صورت طبیعی ساکن محیط هایی مانند دهانه رودخانه‌ها(مصب‌ها)، مناطق ساحلی و دریایی سرتاسر دنیا هستند(26). با توجه به این که فاژ هر دو مطالعه از محیط دریا جدا سازی شده اند می توان گفت هر دو یافته با یک دیگر هم خوانی دارد.یکی از مهم ترین عوامل بیماری زا در صنعت تکثیر و پرورش میگو، عوامل باکتریایی متعلق به خانواده ویبریوناسه بوده که موجب ایجاد بیماری ویبریوزیس در میگوهای خانواده پنائیده و کاهش میزان رشد و بازماندگی در مراکز تکثیر و مزارع پرورش میگو می شوند و خسارات جبران ناپذیری را به صنعت تکثیر و پرورش میگو تحمیل می نمایند. از این رو مطالعه ی حاضر با هدف شناسایی و استفاده باکتریوفاژ به عنوان جایگزینی برای استفاده از آنتی بیوتیک در درمان ویبریوز انجام شد. نتایج نشان داد باکتریوفاژ Vibrio alginolyticus strain Samira Phage جدا شده از سواحل آلوده به فاضلاب بوشهر، قادر تشکیل پلاگ در باکتری های ویبریوز سواحل بوشهر بوده و در غلظت های بالای فاژی این اثرات بیشتر نمایان می گردد که نشان می دهد این باکتریوفاژ کاندیدی مناسب برای استفاده در فاژ درمانی بر علیه این عفونت است.

 

1.Amatul-Samahah, MA., Omar, W., Ikhsan, NFM., Azmai, MNA., Zamri-Saad, M., Ina-Salwany, MY. (2020). Vaccination trials against vibriosis in shrimp: A review. Aquaculture Reports, 18 (3);16-22.1.
2.Bell, JD., Munro, JL., Nash, WJ., Rothlisberg, PC., Loneragan, NR., Ward, RD. (2005). Stock enhancement initiatives. restocking and stock enhancement of marine invertebrate fisheries. Academic Press, 22(5); 143–196.
3.Benyajirapatch, D., Rengpipat, S. (2014). Isolation and characterization of bacteriophages specific to Vibrio cholera. Aquaculture Reports, 13(9);19-26.
4.Choudhury, TG,, Maiti, B., Venugopal, MN., Karunasagar, I. (2012). Effect of total dissolved solids and temperature on bacteriophage therapy against Luminous vibriosis in Shrimp. Applied Microbiology and Biotechnology, 54(9);12-16.
5.Culot. A., Grosset, N., Gautier, M. (2019). Overcoming the challenges of phage therapy for industrial aquaculture: A review. Aquaculture, 513; 734423.
6.Ding, T., Sun, H., Pan, Q., Zhao, F., Zhang, Z., Ren, H, (2020). Isolation and characterization of Vibrio parahaemolyticus bacterio phage vB_VpaS_PG07. Virus Research, 286; 198080.
7.Hou, D., Huang, Z., Zeng, S., Liu, J., Wei, D., Deng, X. (2018). Intestinal bacterial signatures of white feces syndrome in shrimp. Applied Microbiology and Biotechnology, 102; 3701–3709.
8.Hu, F., Guo, Y., Yang, Y., Zheng, Y., Wu, S., Jiang, X. (2019). Resistance reported from china antimicrobial surveillance network (CHINET) in 2018. European Journal of Clinical Microbiology & Infectious Diseases, 38; 2275–2281.
9.Ibrahim, WNW., Leong, LK., Razzak, LA., Musa, N., Danish-Daniel, M., Zainathan, SC. (2021). Virulence properties and pathogenicity of multidrug-resistant Vibrio harveyi associated with luminescent vibriosis in pacific white shrimp, Penaeus vannamei. Journal of Invertebrate Pathology, 107-94.
10.Janda, JM., Newton, AE., Bopp, CA. (2015). Vibriosis. clinics in laboratory medicine. Journal of Invertebrate Pathology, 35; 273–288.
11.Jun JW, Kim HJ, Yun SK, Chai JY, Park SC (2014) Eating oysters without risk of vibriosis: application of a bacteriophage against Vibrio parahaemolyticus in oysters. International journal of food microbiology 188:31–35
12.Kais, SM. (2019). Climate change: vulnerability and resilience in commercial shrimp aquaculture in bangladesh. oceanography and coastal informatics: breakthroughs in research and practice. IGI Global, pp 152–177.
13.Kalatzis, PG., Bastías, R., Kokkari, C., Katharios, P. (2016). Isolation and characterization of two lytic bacteriophages, φSt2 and φGrn1; phage therapy application for biological control of Vibrio alginolyticus in aquaculture live feeds. PloS one, 11; e0151101.
14.Kalatzis, PG., Bastías, R., Kokkari, C., Katharios, P. (2016). Isolation and characterization of two lytic bacteriophages, φSt2 and φGrn1; phage therapy application for biological control of Vibrio alginolyticus in aquaculture live feeds. PloS one, 11; e0151101.
15.Karunasagar, I., Shivu, M., Girisha, S., Krohne, G., Karunasagar, I. (2007). Biocontrol of pathogens in shrimp hatcheries using bacteriophages. Aquaculture, 268; 288–292.
16.Letchumanan, V., Chan, K-G., Pusparajah, P., Saokaew, S., Duangjai, A., Goh, B-H. (2016). Insights into bacteriophage application in controlling Vibrio species. Frontiers in Microbiology, 7;11-14.
17.Lomelí-Ortega, CO., Martínez-Díaz, SF. (2014). Phage therapy against Vibrio parahaemolyticus infection in the whiteleg shrimp(Litopenaeus vannamei) larvae. Aquaculture, 434; 208–211.
18.Luna, L., Hernández, D., Silva, HV., Cobos, MA., González, SS., Cortez, C. (2019). Isolation, biochemical characterization, and phylogeny of a cellulose-degrading ruminal bacterium. Revista Colombiana de Ciencias Pecuarias, 32;117–125.
19.Luo, P., He, X., Liu, Q., Hu, C. (2015). Developing universal genetic tools for rapid and efficient deletion mutation in Vibrio species based on suicide T-vectors carrying a novel counterselectable marker, vmi480. PLoS One, 10; e0144465.
20.Martínez-Díaz, SF., Hipólito-Morales, A. (2013). Efficacy of phage therapy to prevent mortality during the vibriosis of brine shrimp. Aquaculture, 400–401; 120–124.
21.Mateus, L., Costa, L., Silva, YJ., Pereira, C., Cunha, A., Almeida, A. (2014). Efficiency of phage cocktails in the inactivation of Vibrio in aquaculture. Aquaculture, 424–425; 167–173.
22.Matsuzaki, S., Tanaka, S., Koga, T., Kawata, T. (1992). A broad‐host‐range vibriophage, KVP40, isolated from sea water. Microbiology and Immunology, 36; 93–97.
23.Mirbakhsh, M., Zorriehzahra, S., Yeganeh, V., Ghaednia, B., Dashtiannasab, A., Mohammadi Baghmollai, E. (2016). Molecular identification of bacterial and fungal pathogens in certain disease-free shrimp. Journal of Sea Research, 76 (8);231-240.
24.Onarinde, BA., Dixon, RA. (2018). Prospects for biocontrol of Vibrio parahaemolyticus Contamination in Blue Mussels(Mytilus edulus) a year-long study. Frontiers in Microbiology 9:1043.
25.Phumkhachorn, P., Rattanachaikunsopon, P. (2010). Isolation and partial characterization of a bacteriophage infecting the shrimp pathogen Vibrio harveyi. African Journal of Microbiology Research, 4; 1794–1800.
26.Plaza, N., Castillo, D., Pérez-Reytor, D., Higuera, G., García, K., Bastías, R. (2018). Bacteriophages in the control of pathogenic vibrios. Electronic Journal of Biotechnology 31; 24–33.
27.Ramasamy, P. (2019). Phage therapy for control of bacterial diseases. Crustacea, P.89-90.
28.Rasmussen, BB., Kalatzis, PG., Middelboe, M., Gram, L. (2019). Combining probiotic Phaeobacter inhibens DSM17395 and broad-host-range vibriophage KVP40 against fish pathogenic vibrios. Aquaculture, 513;734415.
29.Rezaie, N., Pourshafie, M. (2018). Increased resistance to tetracycline and erythromycin in Vibrio cholerae. clinical isolates isolated from patients with cholera disease during 2012-2013 outbreaks in IR Iran. Infection Epidemiology and Microbiology, 4; 93–98.
30.Ringø, E. (2020). Probiotics in shell fish aquaculture. Aquaculture and Fisheries, 5;1–27.
31.Rowley, AF., Pope, EC. (2012). Vaccines and crustacean aquaculture. A mechanistic exploration. Aquaculture, 334–337; 1–11.
32.Sasikala, D., Srinivasan, P. (2016). Characterization of potential lytic bacteriophage against Vibrio alginolyticus and its therapeutic implications on biofilm dispersal. Microbial Pathogenesis, 101; 24–35.
33.Shinn, A., Pratoomyot, J., Griffiths, D., Trong, T., Vu, NT., Jiravanichpaisal, P. (2018). Asian shrimp production and the economic costs of disease. Asian Fish Sci S., 31; 29–58.
34.Silva, YJ., Costa, L., Pereira, C., Mateus, C., Cunha, A., Calado, R. (2014). Phage therapy as an approach to prevent Vibrio anguillarum infections in fish larvae production. PLoS One, 9; e114197
35.Stalin, N., Srinivasan, P. (2017). Efficacy of potential phage cocktails against Vibrio harveyi and closely related Vibrio species isolated from shrimp aquaculture environment in the south east coast of India. Veterinary Microbiology, 207;83-96.
36.Sweet, MJ., Bateman, KS. (2015). Diseases in marine invertebrates associated with mariculture and commercial fisheries. Journal of Sea Research, 104; 16–32.
37.Sweet, MJ., Bateman, KS. (2016). Reprint of ‘diseases in marine invertebrates associated with mariculture and commercial fisheries. Journal of Sea Research, 113; 28–44.
38.Valente, C de S., Wan, AHL. (2021). Vibrio and major commercially important vibriosis diseases in decapod crustaceans. Journal of Invertebrate Pathology, 181; 107527
39.Vinod, MG., Shivu, MM., Umesha, K., Rajeeva, B., Krohne, G., Karunasagar, I. (2006). Isolation of Vibrio harveyi bacteriophage with a potential for biocontrol of luminous vibriosis in hatchery environments. Aquaculture, 255; 117–124.
40.Wang, D., Mbewe, N., Bels, LD., Couck, L., Stappen, GV., Broeck, WV. (2021). Pathogenesis of experimental vibriosis in blue mussel (Mytilus edulis) larvae based on accurate positioning of GFP-tagged Vibrio strains and histopathological and ultrastructural changes of the host. Aquaculture, 535; 736347.
41.Wang, A., Ran, C., Wang, Y., Zhang, Z., Ding, Q., Yang, Y. (2019). Use of probiotics in aquaculture of China. A review of the past decade. Fish & Shellfish Immunology, 86;734–755.
42.Xie, J., Bu, L., Jin, S., Wang, X., Zhao, Q., Zhou, S. (2020). Out break of vibriosis caused by Vibrio harveyi and Vibrio alginolyticus in farmed seahorse Hippocampus kuda in China. Aquaculture, 523; 735168.
43.Yang, M., Liang, Y., Huang, S., Zhang, J., Wang, J., Chen, H. (2020). Isolation and characterization of the novel phages vB_VpS_BA3 and vB_VpS_CA8 for lysing Vibrio parahaemolyticus. Frontiers in Microbiology, 11; 259.
44.Yuksel, SA., Thompson, KD., Ellis, AE., Adams, A. (2001). Purification of Piscirickettsia Salmonis And Associated Phage Particles. Diseases of Aquatic Organisms, 44; 231–235-309.