ردیابی مولکولی کروناویروس عامل بیماری برونشیت عفونی در مرغ‌های تخم‌گذار مبتلا به اویداکت کیستیک و سندرم کاهش کمی و کیفی تولید تخم

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانش آموخته دانشکده دامپزشکی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران

2 بخش بهداشت و بیماری های طیور، دانشکده دامپزشکی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران

چکیده

زمینه و هدف: سندرم کاهش کمی و کیفی تخم مرغ علل عفونی و غیر عفونی زیادی دارد اما معمولاً این حالت به کرونا ویروس عامل بیماری برونشیت عفونی نسبت داده می شود. در این بررسی سهم کرونا ویروس برونشیت عفونی در این سندرم مورد بررسی قرار گرفته است.
روش کار: از بهار 1398 تا بهار 1399 از 9 فارم مرغ تخم گذار با سابقه کاهش کمی و کیفی تولید تخم مرغ و 10 فارم تخم گذار به ظاهر سالم نمونهگیری شد. علاوه بر آن، از 6 فارم مبتلا به اویداکت کیستیک در مرغداریهای تخم گذار استان اصفهان نمونهگیری شد. پس از استخراج ژنوم قطعه 1200 جفت بازی ژن S1 کروناویروس عامل برونشیت عفونی تکثیر شد.
یافته ها:از 9 فارم تخم گذار مبتلا به سندرم کاهش کمی و کیفی تخم مرغ و 10 فارم به ظاهر سالم، بهترتیب، 7 و 4 فارم(78 و 40 درصد)، با وجود حداقل یک نمونه مثبت، آلوده به کرونا ویروس عامل برونشیت عفونی شناسایی شدند. از مجموع 59 نمونه از فارم­های مبتلا به سندرم کاهش کمی و کیفی تخم مرغ 32 نمونه(2/54 %) و از 66 نمونه گرفته شده از فارم های به ظاهر سالم 7 نمونه(6/10 %) مثبت ارزیابی شدند. در این بررسی، تمام 6 فارم مبتلا به اویداکت کیستیک دارای حداقل یک نمونه مثبت از نظر کرونا ویروس برونشیت عفونی بودند و 31 نمونه از مجموع 41 نمونه(17/73 %) آلوده به کرونا ویروس برونشیت عفونی شناسایی شدند.
نتیجه­گیری:کرونا ویروس برونشیت عفونی سهم بالایی در سندرم کاهش کمی و کیفی تولید تخم در مرغهای تخم گذار دارد اما نمیتوان تمامی موارد را به این ویروس نسبت داد و باید سایر عوامل عفونی و تغذیه ای را نیز پایش نمود. با توجه به فراوانی بالای این ویروس در موارد اویداکت کیستیک لازم است تیپهای ویروسی القا کننده این اختلال شناسایی و برای کنترل آنها برنامه مناسب تدوین شود.

کلیدواژه‌ها


عنوان مقاله [English]

Molecular detection of coronavirus causing infectious bronchitis in laying hens with cystic oviduct and quantitative and qualitative reduction of egg production

نویسندگان [English]

  • Maryam Jalahi 1
  • Majid Gholami-Ahangarn 2
1 Graduated of Veterinary Medicine Faculty, Shahrekord Branch, Islamic Azad University, Shahrekord, IRAN
2 Department of Poultry Diseases, Faculty of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
چکیده [English]

Background and Aim: In this study, the contribution of IB coronavirus in egg quantitative and qualitative reduction syndrome was investigated.
Methods: nine laying hen flocks attected to egg quantitative and qualitative reduction syndrom and 10 laying farms with a healthy appearance were sampled. In addition, 6 farms with cystic oviduct were sampled in laying flocks, in Isfahan province. After extracting the genome, a fragment of 1200 bp of coronavirus S1 gene was amplified for identification of IB.
Results: Out of 9 laying farms with quantitative and qualitative egg reduction syndrome and 10 apparently healthy farms, respectively 7 and 4 farms (78 and 40%) were infected with IB coronavirus based at least one positive sample. Out of 59 samples from farms with egg quantitative and qualitative reduction syndrome, 32 samples (54.2%) and out of 66 samples taken from apparently healthy farms, 7 samples (10.6%) were evaluated positive for IB coronavirus. In this study, all 6 farms with cystic oviduct had at least one positive sample for IB coronavirus and 31 samples out of 41 samples (73.17%) infected with IB coronavirus.
Conclusion: IB coronavirus has a high share in the syndrome of quantitative and qualitative reduction of egg production in laying hens, but not all cases can be attributed to this virus and other infectious and non-infectious factors should be monitored. Due to the high frequency of this virus in cystic oviduct, it is necessary to identify the viral types that induce this disorder and to develop an appropriate control program.

کلیدواژه‌ها [English]

  • Cystic oviduct
  • Quantitative and qualitative reduction of egg production syndrome
  • Infectious Bronchitis
  • Isfahan

بیماری برونشیت عفونی اولین بار در سال 1930 در ایالات متحدة آمریکا به صورت یک بیماری تنفسی بسیار مسری در ماکیان مشاهده شد. هم اکنون برونشیت عفونی در تمام جهان گسترده شده است(11). عامل بیماری یک کرونا ویروس از جنس گاماکرونا ویروس است که دارای 27600 نوکلئوتید می باشد. برخلاف آلفا و بتا کرونا ویروس ها که عمدتاً پستانداران شامل انسان و حیوانات اهلی را آلوده می کند گاما و دلتا کرونا ویروس­ها بیشتر خانواده پرندگان را مبتلا می کند. تاکنون هفت کرونا ویروس با منشاء آلفا و بتا در انسان شناسایی شده است که منجر به بروز علایم تنفسی گردیده است(13). 229E و OC43 در دهه 1960 کشف شدند و عامل عفونت تنفسی در انسان شناخته شدند. در سال 2003 با ظهور سندرم شدیداً حاد تنفسی(سارس)، دو کرونا ویروس دیگر NL63 و HKU1 در انسان کشف شدند. ششمین مورد کرونا ویروس در انسان در سال 2012 در عربستان ظاهر شد و سندرم تنفسی خاورمیانه(مرس) نام گذاری شد. بعد از آن در دسامبر 2019 مورد هفتم از ووهان چین گزارش شد و کووید 19 نام گذاری شد. سارس، مرس و کووید 19 متعلق به گروه بتا کرونا ویروس ها هستند که توانایی ایجاد بیماری شدید را دارند. NL63 و 229E متعلق به تیپ آلفا و HKU1 و OC43 متعلق به گروه بتا هستند که هر 4 گونه بیماری خفیف برای انسان ایجاد می کنند. مخزن طبیعی جنس آلفا و بتاکرونا ویروس ها خفاش معرفی شده است که در مورد سارس، مرس و کووید 19 احتمال می رود این کرونا ویروس ها از طریق یک میزبان واسط در انسان ایجاد بیماری کرده باشند. تحقیقات نشان داده است میزبان واسط گربه سیوت، شتر تک کوهانه و پنگولین(مورچه خوار) به ترتیب در انتقال ویروس عامل بیماری سارس، مرس و کووید 19 به انسان نقش داشته اند 16). تاکنون از جنس گاماکرونا ویروس ها، ویروس­های عمدتاً با منشاء تنفسی از قرقاول، مرغ شاخدار، طاووس، کبک، بوقلمون، غاز، اردک و کبوتر جدا شده است. اگرچه از نهنگ سفید(بلوگا) نیز به عنوان یک پستاندار یک گاما کرونا ویروس جدا شده است اما در شرایط فعلی هیچ گونه شواهدی از این که گاما کرونا ویروس ها در انسان ایجاد بیماری کرده باشند وجود ندارد و لذا بیماری برونشیت عفونی پرندگان از خانواده گاما کرونا ویروس ها از نظر بهداشت عمومی اهمیت ندارد و تاکنون در انسان ایجاد بیماری نکرده است(17 ،13). برونشیت عفونی اهمیت اقتصادی خاصی دارد. اکثر سویه‌های ویروس برونشیت عفونی، موجب ضایعات در نای و دستگاه تنفس می‌شوند که به علت عفونت های ثانویه باکتریایی پیچیده می شود و ممکن است باعث تلفات زیادی شود. سویه‌هایی که به کلیه آسیب می‌رسانند، علاوه بر ضایعات در نای، ضایعات کلیوی نیز ایجاد می‌کنند(12). درواقع، بیماری برونشیت عفونی یک بیماری تنفسی با ضایعات تنفسی، ادراری و تولیدمثلی است که به طور شایع در تمام کشورهای دارای صنعت طیور منتشر شده است. این بیماری از لحاظ اقتصادی یکی از بیماری های مهم طیور است که می تواند باعث تلفات، افزایش هزینه های مربوط به دارو درمانی، حذف لاشه در کشتارگاه، کاهش راندمان غذایی و در گله های تخم گذار باعث کاهش کمی و کیفی تولید تخم مرغ شود. متاسفانه این بیماری یکی از شایع ترین بیماری های تنفسی در ایران است(2).کرونا ویروس عامل بیماری برونشیت عفونی، ویروسی RNA دار و تک رشته با سنس مثبت است. کرونا ویروس ها غشاء دار و معمولاً پلئومورف می باشند که پروتئین های آنتی ژنی و عملکردی آن ها در سطح ویریون حضور دارند. ویریون­های کروناویروس عامل برونشیت عفونی دارای 3 پروتئین اصلی شامل گلیکوپروتئین های خاری(S)، غشایی(M) و پروتئین داخلی نوکلئوکپسید می باشند. پروتئین S دارای دو تحت واحدS1 وS2 است. بررسی ها نشان داده است گلیکوپپتید S1 مسئول القای آنتی بادی­های خنثی کننده ویروس می باشد و اکثر خصوصیات بیولوژی این ویروس مربوط به این گلیکوپپتید می باشد. مطالعات مولکولی نشان داده است که تنها تغییر چند اسید آمینه در قسمت S1 ویروس می­تواند منجر به ایجاد یک سروتیپ جدید شود. از طرفی آلودگی های هم زمان با بیش از یک سروتیپ ممکن است منجر به ظهور سروتیپ های جدید به دنبال نوترکیبی بین دو ویروس برونشیت شود که علاوه بر تنوع آنتی ژنی ویروس های برونشیت عفونی ممکن است باعث تغییر در بیماری زایی ویروس شود بنابراین تغییر آنتی ژنی ویروس و رخداد سروتیپ های متعدد با بیماری زایی متفاوت از یک طرف و طبیعت شدیداً انتقال پذیر بیماری ارزش اقدامات پیشگیری کننده در راستای جلوگیری از بیماری به وسیلة رعایت اصول بیوسکوریتی و ایمن سازی پرندگان با سروتیپ های اختصاصی موجود در منطقه را افزایش می دهد. از آن جایی که ایمنی علیه هر سروتیپ کاملاً اختصاصی است و درجة حفاظت متقابل بین سویه ها با افزایش تفاوت توالی S1 کاهش پیدا می کند (13، 12). بنابراین شناسایی و بررسی دوره­ای سویه های موجود در منطقه و تعیین توالی آن ها در جهت استفاده از واکسن های حاوی سروتیپ های موجود در منطقه یک گام مهم در راستای پیش گیری از این بیماری محسوب می شود(2). بیماری برونشیت عفونی پرندگان سال ها است که در ایران شایع است اما وسعت بیماری و تنوع سروتیپ ها با گسترش صنعت مرغ­داری در کشور بیشتر شده است. تشخیص آزمایشگاهی بیماری برونشیت عفونی تا سال 1994(1373) انجام نشده بود و در این سال آقاخان و همکاران، اولین مورد جداسازی ویروس برونشیت را انجام دادند که در این بررسی صرفاً سویه ماساچوست تشخیص داده شد(3) و استفاده از واکسن های سروتیپ Mass در ایران مانند اکثر نقاط جهان رواج پیدا کرد. اما در سال های 1377-1378 در برخی از نقاط ایران تلفات مربوط به سندرم های تنفسی در فارم هایی که حتی برنامه کامل واکسیناسیون علیه برونشیت عفونی را داشتند نظر محققین را جلب کرد به طوری که وصفی مرندی و بزرگمهری فرد در سال 1379، با روش VN حضور یک واریانت ویروس برونشیت عفونی را در ایران گزارش کردند که بعد از ارسال نمونه ها به آزمایشگاه Weybridge انگلیس به عنوان سروتیپپ 793/B تأیید شد(18). پس از آن، شناسایی این تیپ ویروسی در تمام نقاط ایران گزارش شد و به یک اپیدمی تبدیل شد به طوری که در دهه 1380 به عنوان یک سروتیپ غالب در ایران شناسایی شد(1). مرور گزارشات مختلف داخلی نشان می دهد، مطالعات تعیین ژنوتیپ ویروس برونشیت عفونی در ایران تا قبل از دهه 2010(1391) عمدتاً مربوط به واگیری دو تیپ شایع Mass وB/793 بوده است(2). اما در دهه اخیر گزارشاتی از وجود واریانت های دیگر در ایران به چشم می خورد و نشان می دهد که علاوه بر سروتیپ های غالب ذکر شده ممکن است واریانت هایی نیز حضور داشته باشند که ایمنی زایی با تیپ های ذکر شده قادر به ایجاد حفاظت مطلوب علیه واریانت های موجود نشود. یکی از ویژگی های شاخص ویروس عامل بیماری برونشیت عفونی در ماکیان پدیده نوترکیبی ویروس و اختلاط ژن های ویروس است که منجر به بروز واریانت های زیادی از این ویروس شده است به گونه ای که تاکنون سروتیپ ها و واریانت های زیادی از این ویروس گزارش شده است(12). معمولاً سروتیپ ها و واریانت های جدید بیماری زایی متفاوتی را نشان می دهند. اخیراً در ایران سروتیپ های مختلفی شایع شده است اما بیشترین سروتیپی که در تمام جهان و ایران منتشر شده است سروتیپ ماساچوست است که باعث بروز علایم تنفسی، کلیوی و تولید مثلی می گردد. عوارض تولید مثلی آن منجر به کاهش کمیت و کیفیت تخم مرغ می شود. در این بیماری کیفیت تخم مرغ از نظر پوسته و آلبومین افت می کند. اگرچه عوامل متعدد تغذیه ای از جمله کمبود و عدم تعادل مقدارکلسیم، فسفر، نیز عوامل عفونی که بر روی دستگاه تولید مثل اثر دارند مانند آدنوویروس ها نیز می توانند منجر به بروز مشکلات و ناهنجاری های پوسته تخم مرغ گردند(11)، اما از آن جایی که بیماری برونشیت عفونی در فارم های تخم گذار علایم واضح بالینی و کالبدگشایی ندارد عمدتاً عوارض مربوط به تخم مرغ در فارم های تخمگ ذار به بیماری برونشیت عفونی نسبت داده می‌شود. روش های مختلفی برای شناسایی ویروس برونشیت عفونی وجود دارد. چهره‌ی بالینی و کالبدگشایی در تشخیص این بیماری کمک کننده است اما برای تشخیص قطعی کافی نیست. تشخیص عفونت بر اساس تاریخچه، ضایعات، افزایش تیتر آنتی بادی، شناسایی آنتی ژن ویروس، جداسازی ویروس و ردیابی ژنوم ویروس برونشیت انجام می‌شود(12 ،6). در حال حاضر شناسایی تیپ های مختلف ویروس برونشیت عفونی بر اساس آزمون های مولکولی به دلیل سرعت، دقت و ویژگی بالا از محبوبیت بیشتری برخوردار است. باعنایت به موارد ذکر شده در این مطالعه با روش مولکولی به شناسایی ویروس برونشیت عفونی در فارم­هایی که دارای مشکلات و ناهنجاری مربوط به تولید تخم مرغ بودند پرداخته شد تا سهم ویروس برونشیت در این پدیده مشخص گردد.

مواد و روشها

نمونه گیری

در این مطالعه، در فاصله زمانی بهار 1398 تا بهار 1399 از 9 فارم مرغ تخم گذار با سابقه کاهش تولید به همراه مشکلات مربوط به کیفیت پوسته و آلبومین نمونه­گیری شد. گله هایی که یکی از مشکلات مربوط به استحکام پوسته(پوسته نرم، نازک یا بدون پوسته)، رنگدانه پوسته(کاهش رنگدانه های پوسته در تخم گذارهایی که تولید تخم مرغ قهوه ای می کنند)، شکل تخم مرغ(بد شکلی، دارای خطوط مواج و خط دار بودن تخم مرغ و وجود رسوبات آهکی) و یا کیفیت آلبومین(رقیق شدگی آلبومین و پارگی شالاز) را داشتند، در این مطالعه وارد شدند. هم چنین برای مقایسه نتایج با گروه به ظاهر سالم از 10 فارم مرغ تخم گذار بدون سابقه کاهش قابل توجه تولید و مشکلات مربوط به تولید تخم نمونه گیری شد. نمونه ها از تلفات و یا از پرندگان زنده پس از کالبدگشایی دریافت شدند. نمونه های دریافتی شامل نای و سکال تونسیل بودند که از هر گله حداقل 5 نمونه اخذ شد. نمونه ها در کنار یخ منتقل شده و تا زمان استخراج ژنوم در 70- درجه سانتی‌گراد نگهداری شدند. علاوه بر آن، با توجه مشاهده افزایش بروز ناهنجاری های اویداکت و به طور ویژه، اویداکت کیستیک در مرغداری های تخم گذار در استان اصفهان، در طول این دوره زمانی از 6 فارم مبتلا به این عارضه نمونه گیری شد. نمونه های دریافتی شامل نای و سکال تونسیل بودند که از هر گله حداقل 5 نمونه اخذ شد. نمونه ها در کنار یخ منتقل شده و تا زمان استخراج ژنوم در 70- درجه سانتی گراد نگه داری شدند.

استخراج RNA

RNA ویروس برونشیت عفونی از نمونه های بافتی با استفاده از کیت تخلیص RNA (High Pure Viral Nucleic Acid Kit، ساخت شرکت Roche) مطابق دستورالعمل استخراج شد.

انجام RT-PCR

پس از استخراج RNA، واکنش RT-PCR با استفاده از سیستم RT-PCR یک مرحله‌ای TITAN(ساخت شرکت Roche) انجام شد.اجزای واکنش گر و حجم آن­ها در واکنشRT-PCR به صورت، آب دوبار تقطیر استریل 5/27 میکرولیتر، بافر واکنش RT-PCR(همراه با کلرید منیزیم)10 میکرولیتر، محلول DTT 5/2 میکرولیتر، dNTP ها 1 میکرولیتر، پرایمر فرادست2 میکرولیتر، پرایمر فرودست2 میکرولیتر، مخلوط آنزیمی1 میکرولیتر، RNA الگو4 میکرولیتر در حجم نهایی50 میکرولیتر می‌باشد.پرایمرهای مورد استفاده در این بررسی در واکنش RT-PCR به شرح جدول 1می‌باشد. بعد از اضافه سازی مواد واکنشگر به تیوب هر نمونه، مواد واکنشگر را به خوبی مخلوط کرده و سانتریفوژ نموده تا نمونه در ته تیوب جمع شود. سپس با 30 میکرولیتر روغن معدنی استریل برای جلوگیری از تبخیر، سطح مخلوط مواد واکنش گر پوشانده شد. به منظور ارزیابی صحت روش مورد استفاده و مواد واکنشگر از کنترل مثبت(واکسن H120) و نیز کنترل منفی(که واجد تمام مواد واکنش­گر، بدون RNA می‌باشد) استفاده شد. در این بررسی مرحله واسرشت سازی، هم سرشت سازی و گسترش 35 سیکل مطابق جدول 2 تکرار شد. به منظور الکتروفورز محصول نهایی PCR از ژل آگارز 1% و مارکر 100 جفت بازی(فرمنتاز) استفاده شد. پس از انتقال نمونه‌ها به چاهک ها اختلاف پتانسیل 120 ولت به مدت 60-45 دقیقه برقرار شد و پس از الکتروفورز کامل محصول PCR، با تابش نور اشعه ماورای بنفش به ژل محصول PCR مشاهده شد. تشخیص فرآورده‌های تکثیری با مشاهده آن در زیر دستگاه پرتوتاب ماورای بنفش امکان­پذیر است. وجود باند حدود 1200 جفت بازی مطابق الگوی مارکر و مشابه کنترل مثبت نشان دهنده تکثیر ژن S1 ویروس برونشیت عفونی در نمونه موردنظر بود(2).

نتایج

ارزیابی نتایج در فارم های با سندرم ناهنجاری های تخم گذاری

ارزیابی نتایج در فارم های با سندرم ناهنجاری های تخم­گذاری حاکی از آن بود که از مجموع 59 نمونه گرفته شده از فارم های با سندرم ناهنجاری تخم گذاری، 32 نمونه(2/54 درصد) آلودگی با ویروس برونشیت عفونی را با تکثیر قطعه 1200 جفت بازی ژن S1 نشان دادند(شکل 1). در این مطالعه از 9 فارم تخم گذار مبتلا به سندرم کاهش کمی و کیفی تخم مرغ، 7 فارم(78%) آلودگی به ویروس برونشیت عفونی را با وجود حداقل یک نمونه مثبت از تعداد نمونه های اخذ شده از نای و سکال تونسیل نشان دادند(جدول 3). در 2 فارم با علایم کاهش تولید و مشکلات مربوط به تخم گذاری هیچ نمونه مثبتی یافت نشد(فارم N وP). لذا در صورت صرف نظر از این 2 فارم، از مجموع 48 نمونه گرفته شده از 7 فارم مثبت، 32 نمونه(67%) آلودگی به ویروس برونشیت عفونی داشتند. به عبارتی، می توان بیان نمود که شیوع آلودگی به ویروس برونشیت عفونی در فارم های آلوده 67 درصد می باشد. در فارم های مثبت میزان آلودگی از 40 درصد تا 100 درصد متغیر بوده است(نمودار 1). در فارم های به ظاهر سالم از مجموع 10 فارم، در 4 فارم(40%) حداقل یک نمونه مثبت در PCR ردیابی شد و از مجموع 66 نمونه گرفته شده 7 نمونه(6/10 درصد) مثبت ارزیابی شد(جدول 4). درصد موارد مثبت در فارم های با سابقه ناهنجاری تخم­گذاری از صفر تا 100 درصد متغیر بود در حالی که میزان آلودگی در فارم های به ظاهر سالم از صفر تا حداکثر 30 درصد بود. آنالیز آماری موارد آلودگی در گله‌های مبتلا به کاهش تولید و گله‌های به ظاهر سالم نشان می‌دهد درصد آلودگی به ویروس برونشیت عفونی در گله های با علایم مشکلات تخم گذاری به طور معنی‌دار بیشتر است(P= 0.004)، در حالی که بررسی آماری ارتباط بین کاهش تولید و آلودگی با ویروس برونشیت عفونی، نشان می دهد این همبستگی در سطح فارم وجود ندارد(P= 0.095).

 

جدول 1- توالی و موقعیت پرایمرهای مورد استفاده در RT-PCR

نام پرایمر

توالی (5' به 3')

ژن مورد بررسی

موقعیت

منبع

S1Uni2+

5'CCCAATTTGAAAACTGAACA3'

S1

47-31

(1)

XCE2-

5'CCTCTATAAACACCCTTGCA3'

S1

1193-1170

(1)

 

 

 

 

 

جدول 2- برنامه دمایی مورد استفاده در دستگاه PCR

دما (درجه سانتیگراد)

زمان

شرح

45

45 دقیقه

انجام واکنش نسخه برداری معکوس RNA و سنتز cDNA‍‍

94

2 دقیقه

واسرشت سازی اولیه ‍cDNA

94

30 ثانیه

واسرشت سازی ‍cDNA

48

2 دقیقه

همسرشت سازی

68

2 دقیقه

گسترش

68

10 دقیقه

گسترش نهایی

 

 

 

شکل 1- الکتروفورز محصول RT-PCR در فارم های با سندرم ناهنجاری های تخم گذاری.

(ستون 1: مارکر، ستون 2 : قطعه 1200 جفت بازی مربوط به سویه رفرنس برونشیت عفونی (واکسن H120)، ستون 3تا 5: نمونه­های مثبت برونشیت عفونی در فارم های با سندرم ناهنجاری­های تخم گذاری)

 

 

 

 

 

جدول 3- وضعیت آلودگی به ویروس برونشیت عفونی در فارم های تخم گذار با سندرم کاهش کمی و کیفی تولید تخم

 

کد فارم

فارم­های با سابقه سندرم کاهش کمی و کیفی تخم مرغ

تعداد نمونه های اخذ شده

تعداد موارد مثبت PCR

در صد موارد مثبت PCR

L

6

3

50

M

10

6

60

N

5

0

0

O

7

4

57

P

6

0

0

Q

5

2

40

R

8

7

5/87

S

5

5

100

T

7

5

71

 

 

ارزیابی نتایج در فارم های تخم گذار مبتلا به اویداکت کیستیک

در کالبدگشایی مربوط به پرندگان با عارضه اویداکت کیستیک، اویداکت های متسع و پر از مایعات شفاف شبیه آب جلب توجه می کرد که حجم مایعات در موارد مختلف بین 50 تا 500 میلی‌لیتر متغیر بود(شکل2). بررسی نتایج مربوط به نمونه گیری از فارم­های تخم گذار مبتلا به اویداکت کیستیک نشان می دهد تمام 6 فارم نمونه گیری شده دارای حداقل یک نمونه مثبت از نظر ویروس برونشیت عفونی می باشند و به عبارتی 100% فارم ها آلوده به ویروس برونشیت بودند. از ژنوم استخراج شده از 41 نمونه نای و سکوم دریافت شده از این فارم ها، قطعه 1200 جفت بازی مربوط به ژن S1 ویروس برونشیت عفونی در 30 نمونه تکثیر شد(شکل 3). به عبارتی 17/73 % نمونه ها در فارم های دارای اویداکت کیستیک آلوده به ویروس برونشیت عفونی بودند(جدول 5).

 

جدول 4- وضعیت آلودگی به ویروس برونشیت عفونی در فارم های تخم گذار به ظاهر سالم

 

کد فارم

فارم­های بدون سابقه سندرم کاهش کمی و کیفی تخم مرغ

تعداد نمونه های اخذ شده

تعداد موارد مثبت PCR

در صد موارد مثبت PCR

A

5

0

0

B

10

3

30

C

6

0

0

D

7

0

0

E

5

1

20

F

8

1

5/12

G

6

0

0

H

5

0

0

J

6

0

0

K

8

2

25

 

 

 

 

 

نمودار 1- درصد آلودگی به ویروس برونشیت عفونی در فارم های با سابقه اختلال تخم گذاری

 

 

شکل 2- اویداکت کیستیک در مرغان تخم گذار نمونه گیری شده

 

 

شکل 3- الکتروفورز محصول RT-PCR در فارم های با اویداکت کیستیک

(ستون 1: مارکر، ستون 2 : قطعه 1200 جفت بازی مربوط به سویه رفرنس برونشیت عفونی (واکسن H120)، ستون 3تا 5: نمونه های مثبت برونشیت عفونی در فارم های با مشکل اویداکت کیستیک)

 

 

جدول 5- وضعیت آلودگی به ویروس برونشیت در فارم های تخم گذار مبتلا به اویداکت کیستیک

کد فارم

تعداد نمونه­های اخذ شده

تعداد موارد مثبت در  PCR

درصد موارد مثبت در PCR

U

7

4

57

V

10

7

70

W

6

4

66

X

5

5

100

Y

5

3

60

Z

8

7

5/87


بحث و نتیجه‌گیری

نتایج مطالعه اخیر نشان داد که میزان فراوانی کرونا ویروس عامل بیماری برونشیت عفونی در فارم های با مشکلات تخم گذاری 78% است. به عبارتی 78% فارم­هایی که علایم کاهش شدید تخم گذاری به همراه تغییرات کیفی تخم مرغ را نشان می دهند می توانند آلوده به ویروس برونشیت عفونی باشند. عدم ردیابی ویروس برونشیت عفونی در بقیه موارد نمونه گیری شده از فارم هایی که مبتلا به سندرم کاهش کمی و کیفی تخم بودند می تواند مربوط به سایر عوامل ایجاد کننده این حالت باشد. مرور مطالعات قبلی نشان می دهد عوامل زیادی می توانند منجر به سندرم کاهش کمی و کیفی تولید تخم مرغ شوند. بیماری های عفونی، استرس گرمایی، برخی از کمبودها و مسمومیت ها به ویژه مسمومیت های قارچی شاخص ترین آن ها هستند(10). از بیماری های عفونی علاوه بر برونشیت، در بیماری نیوکاسل افت تولید حتی تا از تخم رفتن کامل به همراه اختلالات پوسته مانند پوسته های خشن و گچی، در سندرم کاهش تولید تخم میزان کاهش تخم تا 50 % به همراه پوسته های نرم و لمبه گذاری و کمرنگ شدن پوسته، در بیماری لارنگوتراکئیت عفونی، کاهش تولید تا 60 درصد به همراه تغییرات رنگدانه پوسته تخم و نیز در بیماری آنفلوانزا کاهش تولید تا 60-70 درصد به همراه اختلالات پوسته تخم گزارش شده است(13). بنابراین با توجه به این که در فارم های تخم گذار مشاهده علایم تنفسی در موارد برونشیت عفونی کمتر جلب توجه می کند لذا کاهش تولید تخم به همراه مشاهده ناهنجاری های تخم نمی تواند یک دلیل محکمی برای وقوع بیماری برونشیت عفونی باشد و بهره­گیری از تکنیک های پاراکلینیکی در تشخیص دقیق­تر بیماری بسیار کمک کننده است. با توجه به این که در مطالعه اخیر در 40 درصد فارم های به ظاهر سالم حداقل یک نمونه مثبت برونشیت ردیابی شده است و حدود 10 درصد نمونه های گرفته شده از این فارم ها برونشیت عفونی را نشان دادند لذا صرفاً قضاوت بر مبنای تکنیک های مولکولی نمی تواند رهیافت درستی برای شناسایی این بیماری باشد لذا بر اساس یافته های مطالعه حاضر مشاهده کاهش تولید به همراه اختلالات و ناهنجاری های کیفی تخم مرغ به همراه مثبت شدن بیش از 10 درصد نمونه ها می تواند یک رهیافت نزدیک به واقعیت باشد. هم زمان با گردش واریانت های ویروس برونشیت عفونی در ایران، در اروپا هر از چند گاهی سروتیپ جدید با چهره بیماری زایی متفاوت از این کرونا ویروس در پرندگان ظاهر می شود. یکی از چهره­های این بیماری در فارم های تخم گذار وجود کیست های اویداکتی و کاهش شدید تولید است که از سال 2003 در هلند مشاهده و گزارش شده است(7). این سروتیپ بعد از وقوع اپیدمی فرم گوارشی برونشیت عفونی(QXIBV) در چین در سال 1999، در اروپا مشاهده گردید که اصطلاحاً QXIBV-Like یا به عبارتی D308 نام گرفت(8). در ایران نیز در سال های اخیر موارد مکرری از کیست های اویداکتی در فارم­های تخم گذار به همراه کاهش شدید تولید تخم در استان­های مختلف و از جمله در اصفهان مشاهده شده است. قبلاً بزرگمهری و همکاران در سال1392 وجود واریانت QX را با روش مولکولی در یک فارم پولت تخم گذار 20 روزه گزارش کرد. بررسی های مولکولی و تعیین توالی ویروس شناسایی شده قرابت 99 درصدی را با گروهی از ویروس های QX چین و قرابت 94 درصدی با ویروس های QX-like اروپا نشان داد. در همین جوجه­ها در 41 روزگی در کالبدگشایی تجمع مایع در اویداکت مشاهده شد. مقایسه توالی نوکلئوتیدی این جدایه ها با سویه های H120 و 91/4 به ترتیب 9/76 و 7/79 درصد بود(5). البته پدیده مشابهی در مرغان تخم­گذاری که در سنین پایین با سروتیپ Mass ویروس برونشیت عفونی مواجه می شوند، گزارش شده است. در جوجه های زیر 10 روز فاقد ایمنی کافی مادری، ویروس سروتیپ Mass قادر به اثرگذاری بر فرآیند تکامل اویداکت بوده و باعث عدم شکل گیری اویداکت و یا اختلالاتی در تکامل اویداکت مانند اویداکت کیستیک می گردد(13). از آن جایی که گفته شده است این پدیده می تواند تحت تاثیر افزایش میزان استروژن آزاد شده از تخمدان اتفاق بیفتد(17). اما در مرغان نمونه برداری شده هیچ گونه تغییرات ماکروسکوپی در وضعیت تخمدان مشاهده نشد و پرندگان نمونه گیری شده از نظر ظاهری تخمدان نرمالی داشتند. لذا به نظر می رسد برخی از سروتیپ های ویروس برونشیت عفونی مانند Mass و به ویژه سروتیپ D308 قادر به ایجاد اویداکت کیستیک باشند. با افزایش فراوانی این پدیده در فارم های تخم گذار این فرضیه متصور شد که ممکن است تیپ شایع D308 که در اروپا در حال گردش است در ایران نیز مشکل آفرین شده باشد. به نظر می رسد این سروتیپ اگرچه در ابتدا در چین به عنوان فرم گوارشی ویروس برونشیت ظاهر شد و باعث التهاب و خونریزی در پیش معده جوجه های گوشتی می گردید(13). اما در فارم های تخم گذار عمدتاً باعث اختلالات تخم گذاری می گردد. به هرحال بررسی های اولیه در مطالعه اخیر نشان می دهد که فارم­های مبتلا به اویداکت کیستیک آلوده به ویروس برونشیت عفونی هستند و مشخص نمودن کامل این موضوع که کروناویروس آلوده کننده متعلق به کدام سروتیپ باشد مستلزم تعیین توالی ژنوم ویروس است اما با توجه به شواهد موجود و گزارشات قبلی احتمال آلودگی با سروتیپ QX وجود دارد. در خصوص واگیری سروتیپ QX در ایران گزارشات متعددی وجود دارد که می تواند تایید کننده ارتباط چهره بالینی اویداکت کیستیک با وجود سروتیپ QX برونشیت عفونی در فارم های تخم گذار اصفهان باشد. قلیانچی و همکاران(1394) به بررسی ژنوتیپ های ویروس برونشیت عفونی در 40 نمونه نای و کلیه از گله های گوشتی مناطق شرق ایران(سیستان و خراسان جنوبی)(متعلق به 1394) پرداختند و بیان نمودند که QX، 6/6 درصد موارد آلودگی به ویروس برونشیت عفونی را در این منطقه به خود اختصاص داده است(8). هم چنین برومند(1397) به تایید حضور ژنوتیپ QX در اهواز پرداخت وبیان کرد که ویروس ردیابی شده شباهت بالایی با سویه های QX ثبت شده از چین و عراق داشته است(بالای 99 درصد)(4). در مطالعه دیگری قلیانچی و همکاران(1398) با بررسی نمونه های متعلق به سال 1396 از 170 فارم جوجه گوشتی مبتلا به سندرم تنفسی واقع در 9 استان نشان داد که ژنوتیپ QX، در 5 درصد موارد بیماری برونشیت عفونی ردیابی شده است(9). لذا با توجه به واگیری ژنوتیپ QX در ایران، به نظر می رسد این ژنوتیپ می تواند در مشکلات مربوط کاهش تولید تخم همراه با وقوع اویداکت کیستیک در فارم های تخم گذار نقش عمده ای داشته باشد.به طورکلی نتایج این مطالعه نشان داد ویروس برونشیت عفونی در ایجاد مشکلات و ناهنجاری های تخم مرغ سهم بالایی دارد و با توجه به واگیری ژنوتیپ QX-like در ایران، مشاهده کاهش شدید تولید تخم به همراه شواهدی از ناهنجاری های تخم مرغ و اویداکت کیستیک می تواند نشان دهنده واگیری برونشیت عفونی در فارم های تخم گذار باشد.

منابع
1-غلامی آهنگران، م.، چرخکار س.، و شوشتری ع.، بزرگمهری‌فرد م.ح، عشرت‌آبادی ف. 1387. شناسایی مولکولی و تعیین تیپ ویروس برونشیت عفونی در موارد سندرم تنفسی جوجه‌های گوشتی در استان اصفهان. مجله علوم دامپزشکی ایران. سال پنجم. شماره 3. ص 476-469.
2-غلامی آهنگران، م.، شوشتری ع.، دوستی ع.، فتحی‌هفشجانی ع.، ضیاء جهرمی، ن. 1391. شناسایی تیپ 91/4 ویروس یرونشیت عفونی در جوجه‌های گوشتی استان چهارمحال و بختیاری. مجله دامپزشکی دانشگاه آزاد اسلامی واحد تبریز. پیاپی 2. ص 1537-1533.
3.Aghakhan, S.M., Abshar, N., Rasoul Nejad Fereidouni, S., Marunesi, C., Khodashenas, M. (1994). Studies on avian viral infections in Iran, Arch Razi Inst, 46/47; 56-63.
4.Boroomand, Z., Jafari, R.A., Mayahi, M. (2018). Molecular detection and phylogenetic properties of isolated infectious bronchitis viruses from broilers in Ahvaz, southwest Iran, based on partial sequences of spike gene. Vet Res Forum, 9(3); 279-283.
5.Bozorgmehri-Fard, M.H., Charkhkar, S., Hosseini, H. (2013). Detection of the chinese genotype of infectious bronchitis virus (QX-type) in Iran. Iran J Virol, 7(1&2); 57-60.
6.Chousalkar, K.K., Roberts, A. (2009). Effects of Australian strains of infectious bronchitis virus on internal and external quality of hen eggs. Anim Prod Sci, 49; 162–169.
7.De Wit, J.J., Nieuwenhuisen-van Wilgen, J., Hoogkamer, A., van de Sande, H., Zuidam, G.J., Fabri, T.H.F. (2011). Induction of cystic oviducts and protection against early challenge with infectious bronchitis virus serotype D388 (genotype QX) by maternally derived antibodies and by early vaccination. Avian Pathol, 40(5); 463-471.
8.Ghalyanchi-Langeroudi, A., Karimi, V., Jannat, A., Hashemzadeh, M., Fallah, M.H., Gholami, F. (2015). Genotyping of infectious bronchitis viruses in the east of iran. Iran J Virol, 9(2); 1-5.
9.Ghalyanchilangeroudia, A., Hosseini, H., Fallah Mehrabadic, M.H., Ghafourid, S.A., Modiri Hamdana, A., Ziafatia, Z. (2019). Genotyping of avian infectious bronchitis virus in Iran: Detection of D274 and changing in the genotypes rate. Comp Immunol Microbiol Infect Dis, 65; 110–115.
10.Hughes, B.O., Gilbert, A.B., Brown, M.F. (1986). Categorisation and causes of abnormal egg shells: relationship with stress. Br Poult Sci, 27(2); 325–337.
11.Ignjatovic, J., Sapats, S. (2000). Avian infectious bronchitis. Rev Sci Tech off Int Epiz, 19(2); 493-508.
12.Jackwood, M.W. (2012). Review of infectious bronchitis virus around the world. Avian Dis, 56(4); 634-641.
13.Jackwood, M.W., de Wit, S. (2020). Infectious bronchitis. In: Swayne, D.E., Boulianne, M., Logue, C.M., McDougald, L., Nair, V., Suarez, D.L., editors. Diseases of Poultry. 14th ed. Wiley-Blackwell, Inc. p. 167–188.
14.Krapez, U., Slavec, B., Rojs, O.Z. (2011). Circulation of infectious bronchitis virus strains from Italy 02 and QX genotypes in Slovenia between 2007 and 2009. Avian Dis, 55(1); 155-161.
15.Miłek, J., Blicharz-Domańska, K. (2018). Coronaviruses in avian species – review with focus on epidemiology and diagnosis in wild birds. J Vet Res, 62; 249-255.
16.Sabato, L., Vaccari, G., Lelli, D., Lavazza, V., Castrucci, MR., Moreno A. (2019). A48 Identification and full-genome characterization of Alpha- and Beta-Coronaviruses viruses from bats in Italy. Virus Evolution, 5(10); 100-110.
17.Srinivasan, P., Balasubramaniam, G.A. (2011). Cystic dilatation of right oviduct in layer chicken. Tamil nadu J Vet Anim Sci, 7; 218-220.
18.Vasfi Marandi, M., Bozorgmehri Fard, M.H. (2000). Isolation and identification of infectious bronchitis virus in chicken in Iran. 21st World Poultry Congress, p. 100