تاثیر لاکتوباسیلوس پلانتاروم و برویس جدا شده از دستگاه گوارش ماهی و تاثیر آن بر شاخص های رشد و ایمنی ماهی کپور معمولی ( Cyprinus carpio) در مقایسه با پروبیوتیک پریمالاک

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی واحد تنکابن

2 هیات علمی -دانشیار گروه شیلات.دانشگاه آزاد اسلامی تنکابن

3 هیات علمی گروه دامپزشکی دانشگاه آزاد اسلامی واحد بابل

4 هیات علمی گروه زیست شناسی دانشگاه آزاد اسلامی واحد بابل

چکیده

زمینه و هدف: گروه های مختلف باکتری های اسیدلاکتیک باکتری هایی می باشند که در اکوسیستم های مختلف وجود داشته با تولید انواعی از فرآورده های میکروبی به اشکال مختلف اثرات مثبت زیادی در اکوسیستم های زیستی دارند که از مهم ترین آن ها می توان به نقش آن ها در درمان بیماری های عفونی و دخالت در رشد و تولید فاکتورهای مهم زیستی اشاره کرد. بنابراین نیاز به شناسایی باکتری های اسیدلاکتیک دارای پتانسیل پروبیوتیکی در اکوسیستم های مختلف می باشد. هم چنین از آن جایی که در صنعت آبزی پروری اعمال مدیریت در رشد و بهداشت و پیش گیری از بروز بیماری های عفونی از اهمیت اقتصادی بالایی برخوردار است، استفاده از ترکیبات محرک سیستم ایمنی می‌‌توانند موجب تقویت سیستم ایمنی گردند و توان موجود را برای رشد بیشتر و مواجهه با شرایط نامساعد محیطی بالا ببرند. این ترکیبات شامل انواع پروبیوتیک ها می باشند، لذا هدف از این تحقیق جداسازی و شناسایی لاکتوباسیل های دارای پتانسیل پروبیوتیکی از دستگاه گوارش سیاه ماهی Capoeta.razii و تاثیر آن بر شاخص های رشد و ایمنی ماهی کپور معمولی Cyprinus carpio بوده است.
روش کار: برای رسیدن به این منظور از دستگاه گوارش سیاه ماهی Capoeta.raziiلاکتوباسیل های دارای پتانسیل پروبیوتیکی با انجام تست های میکروبی و مولکولی جداسازی و شناسایی شدند. در نتیجه 3 باکتری شناسایی شد که 2گونه از آن L.plantarum و یک گونه از آن L.brevis بوده است. تعداد240 قطعه ماهی کپور معمولی با وزن 2±15 گرم بین 12مخزن فایبرگلاسی500 لیتری با تراکم ذخیره سازی 20 عدد مـاهی در چهار تیمار(3 تکرار) که این تیمارها شامل گروه شاهد، گروه ماهیان تغذیه شده با غذای آغشته شده به باکتری لاکتو باسیل برویس به تعداد 106 ، گروه ماهیان تغذیه شده با غذای آغشته شده به باکتری لاکتو باسیل پلانتاروم به تعداد 106 و گروه ماهیان تغذیه شده با غذای آغشته شده به پروبیوتیک پریمالاک بودند.توزیع و تغذیه شدند.
یافته ها: در پایان آزمایش، درگروه ماهیانی که لاکتوباسیل و پریمالاک دریافت کرده بودند، شـاخص هـای رشـد آن ها مانند افزایش وزن، نرخ رشد ویژه، ضریب تبدیل غذا و درصد بقا سطح بالاتر و مطلوب تری را نسبت به گروه ماهیانی که جیره آن ها فاقد لاکتوباسیل و پریمالاک بودند نشان دادند. هم چنین در فاکتورهای ایمنی نیز تعداد RBC و WBC ، پرتئین تام، آلبومین، گلوبولین، C3 افزایش و میزان کورتیزول کاهش یافت.

کلیدواژه‌ها


عنوان مقاله [English]

The effect of Lactobacillus. plantarum and Lactobacillus .Brevis isolated from the gastrointestinal tract of fish and its effect on growth and safety indices of common carp (Cyprinus carpio) in comparison with Primalak probiotic

نویسندگان [English]

  • Meysam Rameshgar 1
  • mohammadreza ghomi 2
  • Seyed Masoud Hashemi Karoui 3
  • Syed Mahdi Hoseini Fard 3
  • Seysd Reza Tabari Pour 4
1 Department of Aquacalture . Islamic Azad university . Tonekabon branch . Tonekabon iran
2 Department of Aquacalture . Islamic Azad university . Tonekabon branch . Tonekabon
3 Department of Veterinary . Islamic Azad university . Babol branch . Babol iran
4 Department of biology . Islamic Azad university . Babol branch . .
چکیده [English]

Different groups of lactobacilli have probiotic potential of bacteria that have many positive effects on biological ecosystems in various forms. Also, in intensive fish farming, their use is one of the ways to improve growth, nutrition and survival indices. In the meantime, various researches have been done on probiotics as practical supplements in fish nutrition. Therefore, the need to identify lactobacilli with probiotic potential seems to be very important. Therefore, the aim of this study was to isolate and identify lactobacilli with probiotic potential from the gastrointestinal tract of Capoeta.Razii and its effect on growth and safety indices of common carp Cyprinus carpio.
To achieve this, lactobacilli with probiotic potential were isolated and identified from the gastrointestinal tract of Capoeta.Razii by microbial and molecular tests. Of the 3 bacteria identified, 2 were L.Pantarum and one was L. Brevis.
240 pieces of common carp weighing 15 2 2 g were distributed and fed among 12 fiberglass tanks of 500 liters with a storage density of 20 fish in four treatments (3 replications). At the end of the experiment, in the group of fish that received Lactobacillus and Primalak, their growth characteristics such as weight gain, specific growth rate, feed conversion ratio and survival percentage showed a higher and more desirable level than the group of fish whose diet did not contain Lactobacillus and Primalak. (0.05). Also in immune factors, the number of RBC and WBC, total protein, albumin, globulin, C3 increased and the amount of cortisol decreased.

کلیدواژه‌ها [English]

  • "Common carp"
  • "Growth indices"
  • "Safety indices"

علی رغم پیشرفت های انسان در سطوح مختلف و هم چنین رشد سریع جمعیت طی قرون متمادی، هنوز هم مسائل و مشکلات فراوانی زندگی بشر را تهدید می کند که در این میان بحث تغذیه و تامین غذای کافی و سالم، از بدو خلقت تا کنون، یکی از دغدغه های حیاتی انسان بوده است(2). مصرف آبزیان از دیرباز به عنوان یکی از غذاهای بسیار مهم، هم از نظر ارزش های غذایی و هم از نظر روش های دارویی مطرح بوده است. در عصر حاضر نیز با توجه به رشد روز افزون جمعیت و در حالی که نیمی از مردم دنیا دچار سوء تغذیه هستند، ماهی و آبزیان می­توانند در مقام تامین پروتئین مصرفی جایگاه ویژه ای را داشته باشند(4). پرورش آبزیان به عنوان یکی از فعالیت­های مهم تولیدی در بسیاری از کشورهای جهان محسوب می شود. کمبود منابع آبی سبب شده که در اکثر کشورها پرورش متراکم جایگزین روش های نیمه متراکم و گسترده گردد. در تولید متراکم که موجودات آبزی همواره در معرض شرایط تنش زا و بیماری‌ قرار گرفته و این تنش موجب ایجاد بیماری و ضررهای اقتصادی می‌گردد از آن جا که واکسن ها به تنهایی نمی تواند به عنوان کنترل کننده عمومی بیماری ها در آبزیان استفاده شوند. یک روش جدید استفاده از باکتری های پروبیوتیک مانند لاکتوباسیل ها در کنترل پاتوژن های بالقوه با آنتی بیوتیک ها و مواد شیمیایی در کنترل بیماری در صنعت آبزی پروری اهمیت دارد، با این حال استفاده از آنتی بیوتیک ها احتمال مقاوم شدن میکروارگانیسم ها را به دارو را زیاد کرده و هم چنین ممکن است میکروب­های معمول حاضر در روده ماهی را که بسیار مفیدند از بین ببرند(24). استفاده از تکنولوژی نوین در افزایش بهره وری و کاهش هزینه تولید از جمله مواد قابل اهمیت در آبزی پروری پایداراست. در این خصوص به کار گیری فنون نوین زیستی و روش های تلفیقی کشاورزی - آبزی پروری و طراحی نوین سیستم های تکثیر وپرورش آبزیان بسیار اهمیت دارد و هم چنین استفاده از باکتری های مفید زیستی یا زیست یار، از جمله فناوری های نوین زیستی می­باشد(3). به طور کلی هورمون ها، آنتی بیوتیک ها، ترکیبات غذایی گوناگون و نیز برخی عصاره های گیاهی به عنوان مکمل های غذایی هستندکه به منظور ارتقاء کیفی و کمی تولیدات آبزی پروری مورد استفاده قرار می­گیرند، اما این موارد گاهی خود می توانند سبب کاهش یا بروز اختلالاتی در فعالیت های میکروبی در روده ماهیان شوند، اما استفاده از بعضی پروبیوتیک ها به عنوان مکمل­های غذایی می تواند این نتیجه را جبران کند(14). پروبیوتیک‌ها غذاهای کمکی اند که آنزیم های جانبی آن­ها می‌توانند باعث افزایش فرایند هضم شود. این میکروارگانیسم ها نه تنها باعث کاهش باکتری های بیماری زا در محیط و موجود زنده می‌شوند بلکه با ایجاد و تقویت میکروارگانیسم های مفید موجود در دستگاه گوارش، موجبات سلامتی و یا افزایش میزان رشد را در موجودات زنده فراهم می آورد(12). ممنوعیت استفاده از آنتی بیوتیک به عنوان درمان در اروپا وافزایش فشار برای کاهش استفاده از آنتی بیوتیک درخوراک درمناطق دیگر جهان وجود دارد. افزودن پروبیوتیک به غذا یکی از گزینه­های جایگزین است و می تواند به عنوان جایگزینی برای آنتی بیوتیک ها استفاده شود. شواهد کافی وجود دارد که نشان می دهد پروبیوتیک ها اثرات فعال در افزایش سیستم ایمنی بدن، افزایش وزن بدن ، کاهش اسهال و بهبودتبدیل خوراک دارند(12). پروبیوتیک ها برای ایجاد اثرات سودمند در بدن باید قادر به رشد در معده و روده بوده و توانایی سکونت در آن جا را داشته باشند به همین منظور باید مقاومت لازم جهت مواجه شدن با اسیدکلریدریک معده و نمک های صفراوی موجود در روده در آن ها وجود داشته باشد(28). لاکتو باسیل ها دارای گونه های مختلفی هستند که به طور گسترده به عنوان پروبیوتیک برای انسان و حیوانات مورد استفاده قرار می گیرند(33). این باکتری ها معمولاً با محیط های مغذی همانند غذاها، مواد پوسیده و سطوح های مخاطی دستگاه گوارش و دستگاه ادراری در ارتباط هستند(18). لاکتوباسیل ها، باسیل های گرم مثبت،ب دون حرکت، اسپورزا، کاتالیز منفی و اکسیداز منفی است که قند های مختلف را به لاکتات و استات تبدیل می کند(13). ماهی کپور معمولی یکی از ماهی های پرورشی شناخته شده در دنیاست که منبع غذایی مهمی محسوب می گردد. هرچند این گونـه به صورت بومی و طبیعـی در تمـام سـواحل دریـای خـزر وجـود دارد و بــرای تولیـدمثل وارد مصــب رودخانــه هــا می شود، اما در سال های اخیر به علت صید بیش از حد و از بین رفتن محل های تولیدمثل، نسل آن کـاهش پیـدا کـرده است(15). برای جبران این مسئله و به منظور بازسازی ذخایر اقدام به تکثیر نیمه طبیعی مـاهی شده است. ولـی بقـا و بـازدهی پـایین در مراکـز تکثیـر و پرورش ماهی یکی از بزرگ ترین عوامل مؤثر در جلوگیری از بازسازی مناسب ذخایر ماهی است. به نظر می­رسد یکی از گزینه ها با توجه بـه شـرایط کشـور، استفاده از محرک های رشد و ایمنی باشد(11). باتوجه به مقرون به صرفه بودن پرورش کپور و هم چنین مطالعات محدود در مورد لاکتوباسیل های دارای توان پروبیوتیک در جیره غذایی بچه ماهیان کپور، مطالعه حاضر به جداسازی و شناسایی مولکولی لاکتوباسیل های دارای پتانسیل پروبیوتیک از دستگاه گوارش سیاه ماهی رودخانه­ای( Capoeta.razii ) که یک ماهی بومی رودخانه های مازندران است و تاثیر آن بر شاخص های رشد و ایمنی ماهی کپور معمولی( Cyprinus carpio ) در مقایسه با پروبیوتیک پریمالاک که یک پروبیوتیک تجاری می باشد می پردازد.

مواد و روش ها

 نمونه گیری و آماده سازی

16قطعه ماهی از رودخانه هایی که وجود ماهی Capoeta.razii در آن ها گزارش شده بود صید گردید و به صورت زنده به آزمایشگاه دانشگاه آزاد اسلامی واحد بابل منتقل و در آزمایشگاه دستگاه گوارش هر ماهی به طور جداگانه با بلندر کاملاً میکس و هموژن جهت جداسازی لاکتو باسیل ها استفاده شد(35).

جداسازی باکتری ها

برای جداسازی باکتری ها، از سوسپانسیون فوق به محیط MRS براث Merck آلمان انتقال داده شد. سپس 48 ساعت در شرایط میکرو آئروفیلیک با گاز پک C Merck آلمان و در جار بی هوازی در دمای 37 درجه سانتی گرادانکوبه شد(21). بعد از 48 ساعت از محیط کشت MRS نمونه جهت خالص سازی در محیط کشت MRS آگار Merck آلمان کشت داده و به مدت 48-24 ساعت در شرایط میکرو آئروفیلیک با گاز پک C و در جار بی هوازی در دمای 37 درجه سانتیگرادانکوبه گردید(9). پس از رشد باکتری ها و ایجاد کلنی، انواع کلنی ها شناسایی شده، سپس رنگ آمیزی گرم و تست­های اکسیداز، کاتالاز و تحرک انجام گردید و باکتری­های رشد یافته لاکتو باسیل شناسایی و پس از آن در محیط کشت MRS آگار Merck آلمان کشت داده و جدا سازی آنها انجام گرفت(24).

بررسی پتانسیل پروبیوتیکی باکتری های جداسازی شده

جهت بررسی پتانسیل پرو بیوتیکی باکتری های جداشده مقاومت آن ها در برابر اسید و املاح صفراوی تعیین شد. برای بررسی مقاومت ایزوله های لاکتوباسیلوس به شرایط اسیدی ابتدا ایزوله ها در محیط کشت MRS براث Merck کشت داده به مدت 48 ساعت در جار بی­هوازی در شرایط میکرو آئروفیلیک با گاز پک C Merck آلمان و به روش استاندارد پروبیوتیک های ایران انجام شد(1).

مقاومت به نمک های صفراوی

ایزوله هایی از لاکتوباسیلوس که شرایط اسیدی را تحمل نموده اند، جهت بررسی مقاومت به نمک صفراوی(Oxgall) انتخاب شدند برای هر ایزوله دو لوله، MRS براث Merck آلمان دارای 3/0% نمک صفراوی Oxgall(سیگما-آلمان) و فاقد نمک صفراوی(کنترل) نظر گرفته و به روش استاندارد پروبیوتیک های ایران انجام شد(1).

استخراج DNA

DNA ژنومیک با استفاده از کیت استخراج ROCHE با توجه به پروتکل موجود در کیت مذکور از نمونه های مربوطه استخراج گردید. سپس نمونه های DNA ژنومیک جهت تکثیر بخشی از ژن 16S rRNA با اندازه تقریبی 200 جفت باز به وسیله پرایمرهای اختصاصیF- CTCAAAACTAAACAAAGTTTC وR- CTTGTACACACCGCCCGTCA مورد استفاده قرار گرفت. تکثیر قطعه مورد نظر در حجم lµ  50باحضور Mµ200 از dNTPs،mM 5/1 MgCL2،  nM200 از هر یک از پرایمرهای اختصاصی، 5/1 واحدTaq DNA polymerase انجام شد. شرایط تکثیر DNA در ترموسایکلرC ˚ 94 سه دقیقه، سپس 35 سیکل در C ˚ 94  یک دقیقه  ،C ˚ 53 به مدت 45 ثانیه، C ˚ 72 به مدت 45 ثانیه و نهایتا C˚72 به مدت10 دقیقه بوده است. محصولات حاصل از روش PCR به منظور صحت انجام واکنش با استفاده از روش الکتروفورز بر روی ژل آگاروز 5/1 درصد بررسی شدند و پس از اطمینان از صحت انجام واکنش، محصولات حاصله جهت تعیین توالی به شرکت bioneer ارسال گردیدند. پس از تعیین توالی کروماتوگرام توالی ها با استفاده از نرم افزار chromas version 3.1 تجزیه و تحلیل گردیده و سپس با استفاده از نرم افزار Basic Local Alignment Search Tool(BLAST) با دیگر توالی های موجود در بانک ژن مقایسه شدند. پس از آن توالی ها با استفاده از روش clstalW از نرم افزار Mega10 هم تراز شده و آنالیزهای فیلوژنتیکی با استفاده از روش Maximum Parsimony صورت گرفت.

ذخیره سازی ماهیان

تعداد240 قطعه بچه ماهی کپور معمولی با وزن 2±15 گرم بین 12مخزن فایبرگلاسی500 لیتری به صورت کاملاً تصادفی با تراکم ذخیره سازی 20 عدد مـاهی(3 تکرار) توزیع شدند، که این تیمارها شامل گروه شاهد، گروه ماهیان تغذیه شده با غذای آغشته شده به باکتری لاکتوباسیل برویس به تعداد 106، گروه ماهیان تغذیه شده با غذای آغشته شده به باکتری لاکتو باسیل پلانتاروم به تعداد 106 و گروه ماهیان تغذیه شده با غذای آغشته شده به پروبیوتیک پریمالاک بودند. مخـازن پرورشی قبل از ذخیره سازی، به وسیله هیپوکلریت سدیم با غلظت ماده مؤثر L/mg 200 به مـدت 1 سـاعت کـاملاً ضـدعفونی، سـپس بـاآب شستشـو شـدند. ضـد عفـونی ماهیان نیز ابتـدا بـا غوطـه وری در محلـول نمـک 4 %بـه مــدت 1 دقیقــه انجــام شــد(6 ). به هریک از مخـازن یک سنگ هوا که به یک هواده مرکزی متصل بود، جهـت هـوادهی و تـأمین اکسـیژن نصـب گردیـد. آزمـایش بـه مدت 60 روز با دوره نـوری 12 سـاعت روشـنایی و 12 ساعت تاریکی در یک سالن سرپوشـیده انجـام شـد.

شمارش باکتری ها و اسپری آن بر روی غذای ماهی

پـس از آمـاده سـازی سوسپانسـیون بـاکتری از روش کـدورت سـنجی استفاده گردید و تعداد تقریبی باکتری را در آن محلول مشخص شد. ایـن مرحلـه را در اصـطلاح اسـتاندارد نمـودن تعـداد باکتری می گویند. برای این منظور در آزمایشگاه ها از محلول استانـدارد نیم مک فارلند اسـتفاده مـی شـود به این ترتیب که سوسپانسیون باکتری را با مایع نیم مک فارلند مقایسه نموده و اگر از نظر کدورت مشابه هـم باشـند ،به این معنا می باشد که در هر میلی لیتر از سوسپانسـیون تعـدادCFU/ml  108 بـاکتری وجود دارد. جهت تعیین مقدار باکتری از دستگاه­ها اسپکتروفتومتر با طول موج 520 نانومتر استفاده شد و پس از تعیین مقدار باکتری مورد نیاز، بر روی غذای ماهی اسپری گردید. جهت پیشگیری از حل شدن سریع باکتری مقداری روغن سویا بر سطح غذا اسپری شد(35).

تغذیه ماهیان

به منظور تغذیه ماهیان از غذای کنستانتره شرکت فرادانه بـرای کلیـه تیمارهـا اسـتفاده گردیـد کـه آنـالیز اجزای آن در جدول 1 ارائه شده و غذادهی در حد سیری طی دوره پرورش و 3 بار درروز(در ساعت های 10 ،14و 18 ) انجام شد.

پروبیوتیک پریمالاک

پروبیوتیــک پریمالاک استفاده شده در این مطالعه دارای 4 سویه باکتری بـا نسـبت هـای برابر شامل Lactobacillus acidophilus ،Lactobacillus casei ،  Enterococcus faecium وBifidobacterium bifidium است که از شرکت گلپاد تهران تهیه شده و به میزان 0.01 درصد جیره غذایی مورد استفاده قرار گرفته است(29).

شاخص های رشد

در پایان دوره 60 روزه، همه ماهیان در هر تیمار به وسیله ترازو دیجیتالی(با دقت 01/0 گرم) وزن گردیده و میزان افزایش وزن، نرخ رشد ویژه، ضریب تبدیل غذا و با اسـتفاده از فرمـول هـای زیـر به عنوان شاخص های رشد محاسبه گردید.

افزایش وزن بدن :( BWI = Wt2–Wt1 (31

گرم وزن اولیه ماهی Wt1 = و گرم وزن نهایی ماهی Wt2 =

درصد افزایش وزن بدن : PBWI (%) = [(Wt2 –Wt1/Wt1)] ×100  (18) 

گرم وزن اولیه ماهی Wt1 = و گرم وزن نهایی ماهی Wt2 =

نرخ رشد ویژه : SGR(% /day) = [(LnWt2 – LnWt1) / t]×100 (15)

لگاریتم وزن اولیه ماهی = LnWt1 و لگاریتم وزن نهایی ماهی = LnWt2

ضریب تبدیل غذایی :   FCR = g dry feed eaten / g live weight gain (15)

وزن غذای خورده شده توسط ماهی به گرم =  g dry feed eaten

وزن به دست آمده ماهی به گرم = g live weight gain

فاکتوروضعیت : CF = [W / L3]×100 (26)

طول کل ماهی به سانتی متر = L و وزن بدن ماهی به گرم = W

شاخص های ایمنی

در پایان دوره خون گیری از ماهیان از ناهیه ساقه دمی انجام شده و خون هر ماهی جهت ارزیابی فاکتورهای سرمی خون وارد لوله آزمایش استریل شد. پس از پایان عملیات خون گیری، نمونه های خون در دمای 4 درجه سانتی گراد در داخل کلمن و در مجاورت یخ به آزمایشگاه منتقل و در آزمایشگاه میزان گلبول قرمزRBC(عدد در میلی متر مکعب)، گلبول سفیدWBC(عدد در میلی متر مکعب)، پروتئین تامTp(میلی گرم بر میلی لیتر)،آلبومین ALB(میلی گرم بر میلی لیتر)، ایمنو گلبولین IG(میلی گرم بر میلی لیتر)، C3 و کورتیزول(میکروگرم بر دسی لیتر) اندازه گیری شد.

نتایج

در این تحقیق از دستگاه گوارش 16 قطعه سیاه ماهی Capoeta.razii با عمل رنگ آمیزی گرم و تست های کاتالاز، اکسیداز و حرکت، 9 لاکتو باسیل جداگردید، که درجدول شماره 2 ذکر شده است. سپس تست مقاومت نسبت به اسیدی بر روی باکتری ها انجام گردید که نتایج آن طبق جدول شماره 3 می باشد. بعد از انجام تست مقاومت اسید باکتری هایC9 و C5 و C2 درماهی Capoeta.razii شرایط اسیدی را تحمل نمودند که این باکتری ها جهت انجام تست مقاومت در مقابل نمک های صفراوی انتخاب شدند، که نتایج آن در جدول شماره 4 گزارش گردیده است. باکتری های C9 و C5 و C2 در ماهی Capoeta.razii با توجه به مقاومت در مقابل اسید و نمک های صفراوی برای شناسایی نوع باکتری استخراج DNA شده و آزمایشات PCR با پرایمر GACGTCAATTTCCCCTGTCTTCCTTAGAATGTAGGTGATCCAGCCGCAGGTTCTCCTACG

GCTACCTTGTTACGACTTCACCCTAATCATCTGTCCCACCTTAGGCGGCTGGTTCCTAAA

AGGTTACCCCACCGACTTTGGGTGTTACAAACTCTCATGGTGTGACGGGCGGTGTGTACA AGA انجام گردید. پس از تکثیر بخشی از ژن S rRNA16 توسط واکنش زنجیره ای پلی مراز و تایید قطعه مورد نظر(شکل 1) نمونه های محصولات PCR پس از توالی یابی نیز هر کدام توسط نرم افزار Blast مورد بررسی قرار گرفتند که توالی های مربوط به باکتری های جدا شده C2 و C5 تشابه زیادی را با گونه L.plantarumو باکتری های جدا شده C9 تشابه زیادی را با گونه L.brevis نشان دادند. ارتباط فیلوژنتیکی بین توالی های جدا شده 2C، 5C و 9C و ژنوتیپ های مختلف از لاکتوباسیلوس ها بر اساس ژن s rRNA 16در شکل های 2 ،3 و4 نشان داده شده است. نتایج نشان داد که مصرف روزانه باکتری های لاکتوباسیل برویس و لاکتو باسیل پلانتارم و هم چنین پروبیوتیک پریمالاک اثرات مثبت بر روی شاخص های رشدوزن گیری ماهی کپور معمولی نسبت به گروه کنترل طبق جدول 5 را دارا می باشد(05/0< P).

تاثیر باکتری های جدا سازی شده و پربیوتیک پریمالاک بر روی شاخص های ایمنی

نتایج نشان داد که مصرف روزانه باکتری های لاکتوباسیل برویس و لاکتو باسیل پلانتارم و هم چنین پروبیوتیک پریمالاک اثرات مثبت بر روی شاخص های ایمنی ماهی کپور معمولی نسبت به گروه کنترل طبق جدول 6 را دارا می باشد(05/0< P).

 

 

جدول 1 -آنالیز تقریبی جیره غذای استفاده شده در این مطالعه

مواد مغذی

درصد

پروتئین

38-41

چربی

4-8

رطوبت

5-11

خاکستر

7-11

فیبر

3-6

فسفر

1-1.5

 

جدول 2- شناسایی خصوصیات کلنی های ایجاد شده در MRS  آگار مربوط به دستگاه گوارش ماهیان Capoeta.razii

باکتری

کاتالاز

اکسیداز

حرکت

نوع و گرم

C1

-

-

-

باسیل گرم +

C2

-

-

-

باسیل گرم +

C3

-

-

-

باسیل گرم +

C4

-

-

-

باسیل گرم +

C5

-

-

-

باسیل گرم +

C6

-

-

-

باسیل گرم +

C7

-

-

-

باسیل گرم +

C8

-

-

+

باسیل گرم +

C9

-

-

-

باسیل گرم +

باکتری های C9 _ C1 مربوط به سیاه ماهیCapoeta.razii

 

 

جدول 3- جدول مقاومت باکتری ها در مقابل شرایط اسیدی

باکتری

شرایط اسیدی

C1

-

C2

+

C3

-

C4

-

C5

+

C6

-

C7

-

C8

-

C9

+

باکتری های C9 _ C1 مربوط به سیاه ماهیCapoeta.razii

 

 

 

شکل 1-نتایج الکتروفورز ژل آگارز از محصولات PCR M مارکر، ردیف 1، 2، 3 به ترتیب : محصولات PCR از باکتری های جدا شده C2و C5و C9 می باشد.

 

شکل 2- رابطه فیلوژنی بین توالی های جدا شده C2و برخی از اعضای L.plantarum باروش Maximum Parsimonyبر اساس توالی 16s rRNA . Staphylococcus aureus strain ATCC 12600 (NR_118997) به عنوان گروه خارجی استفاده شد.

 

 

 

 شکل 3- رابطه فیلوژنی بین توالی های جدا شدهC5 و برخی از اعضای L.plantarum باروش Maximum Parsimony بر اساس توالی( s rRNA Staphylococcus aureus strain ATCC 12600 (NR_11899716 به عنوان گروه خارجی استفاده شد.

 

شکل 4- رابطه فیلوژنی بین توالی های جدا شده C9و برخی از اعضای L.brevis باروش Maximum Parsimony بر اساس توالیrRNA . Escherichia coli (NR_024570s 16 به عنوان گروه خارجی استفاده شد.

 

جدول 5- تاثیر باکتری های جدا سازی شده و پربیوتیک پریمالاک بر روی شاخص های رشد اثر باکتری های لاکتو باسیل برویس ، لاکتوباسیل پلانتارم و پروبیوتیک پریمالاک بر روی شاخص های رشد در ماهی کپور معمولی نسبت به گروه کنترل .

           تیمار

شاخص

شاهد

لاکتوباسیل برویس

لاکتو باسی پلانتاروم

پریمالاک

وزن اولیهW1

a

11136/0±12/15

a

45325/0±57/15

a

35157/0±57/15

a

30643/0±52/15

وزن نهاییW2

a

11136/ 0±44/22

b

56092/0±87/23

c

22869/0±00/27

d

43715/0±04/29

ظریب تبدیل غذاFCR

a

23629/0±59/3

b

12124/0 ±05/3

c

19519/0±26/2

d

15308/0±20/2

درصد مصرف غذای روزانه FI

a

17349/0 ±38/2

a

07810/0 ±17/2

a

25865/0±44/2

a

22143/0±24/2

درصد افزایش وزن بدن pBWI

a

037433/0±41/48

b

95312/0±73/52

c

98799/2±45/73

d

06462/3±14/87

افزایش وزن بدن BWI

a

08000/0±32/7

b

12000/0±21/8

c

23000/0±43/11

d

36000/0±52/13

نرخ رشد ویژهSGR

a

00577/0±6567/0

b

01155/0±7067/0

c

02646/0±9200/0

d

02887/0±0433/1

فاکتور وضعیت CF

bc

02646/0±46/1

ab

02646/0±42/1

c

02000/0±49/1

a

02000/0±41/1

وزن گیری روزانه  ADG

a

00100/0±1220/0

b

00200/0±1370/0

c

00351/0±1907/0

d

00600/0 ±2250/0

حروف غیر همسان برروی اعداد نشانگر وجود اختلاف معنی دار است

 

 

 

 

 

 

جدول 6- اثر باکتری های لاکتو باسیل برویس ، لاکتوباسیل پلانتارم و پروبیوتیک پریمالاک بر روی شاخص های ایمنی در ماهی کپور معمولی نسبت به گروه کنترل

 

         تیمار

 

شاخص

شاهد

لاکتوباسیل برویس

لاکتوباسیل پلانتاروم

پریمالاک

گلبول قرمزRBC

(عدد در میلی متر مکعب)

a

9713/0 ± 18333

ab

5185/0 ± 18600

ab

06028/0 ± 18933

b

08737/0 ± 20033

گلبول سفیدWBC

(عدد در میلی متر مکعب)

a

45503/321 ± 33/10733

b

52358/489 ± 66/11456

C

08271/274 ± 66/12573

 

C

72751/160 ± 33/13033

 

پروتئین تامTp

(میلی گرم بر میلی لیتر)

a

10504/0 ± 43/2

b

34819/0 ± 20/3

b

49689/0 ± 33/3

b

16442/0 ± 61/3

آلبومین ALB

(میلی گرم بر میلی لیتر)

a

08737/0 ± 69/1

a

10504/0 ± 68/1

a

08145/0 ± 77/1

a

11372/0 ± 86/1

ایمنو گلبولین IG

(میلی گرم بر میلی لیتر)

a

12646/0 ± 74/0

b

45177/0 ± 52/1

b

57012/0 ± 55/1

b

0950/0 ± 74/1

C3

a

5568/0 ± 3420/0

ab

03055/0 ± 3953/0

bc

0441/0 ± 4687/0

c

03606/0 ± 5320/0

کورتیزول

(میکروگرم بر دسی لیتر)

a

50157/26 ± 33/1571

a

51595/23 ± 00/1566

a

00556/30 ± 33/1551

a

46338/53 ± 33/1534

حروف غیر همسان برروی اعداد نشانگر وجود اختلاف معنی دار است


بحث و نتیجه گیری

در این مطالعه 2 گونه باکتری با نام های Lactobacillus.plantarum و Lactobacillus.brevisکه دارای پتانسیل بودند از ماهیCapoeta.razii  که از گونه های بومی رودخانه های شمال کشور ایران می باشد شناسایی شد. هم چنین در این مطالعه یک روش کارآمد و دقیق برای تشخیص گونه های باکتری اسیدلاکتیک ارائه شد.گونه های شناسایی شده از لاکتوباسیل ها نسبتاٌ مشابه گونه های توصیف شده توسط باکیوگالیندو و همکارانش می باشد. که گونه هایی از باکتری های لاکتوباسیل را از روده ماهی جدا کردند. با این حال ماهی که در این مطالعه مورد استفاده قرار گرفت یک گونه بومی ایران بوده که از رودخانه را جمع آوری شده است(8). J.feng و همکارانش در سال 2019 موفق به جداسازی باکتری های L. sakei و L. plantarum از ماهی کفشک زیتونی Paralichthys olivaceus شدند. هم چنین chang ho و همکارانش در سال 2019 لاکتوباسیل پلانتارم را از صدف دریایی جدا کردند که با تحقیق حاضر مطابقت دارد(17). ماهی ها ممکن است در تمامی مراحل زندگی در معرض باکتری های موجود در محیط قرار گیرند که بعضی از آن­ها مضر و برخی دیگر مفید می باشند. برای کنترل عوامل بیماری زا بایداز باکتری هایی همانند لاکتوباسیل­ها که دارای اثرات بهداشتی مفیدی می باشد استفاده کرد. در بسیاری از تحقیقات اهمیت استفاده از این باکتری ها بالاخص در آبزی پروری نشان داده شده است. به عنوان نمونه N. Van Nguyen و همکارانش در سال 2019 تاثیر باکتری Lactobacillus plantarum strain L-137-HK L-137  را بر روی ماهی تیلاپیای نیل Oreochromis niloticus آزمایش کردند که اثرات مثبتی بر روی رشد ، سیستم ایمنی و مقاومت در برابر استرس در این ماهی را به دنبال داشت(26). هم چنین M.A.O . Dawood  و همکاارنش در سال 2015 تاثیر باکتریLactobacillus plantarum ( (LP20را بر روی بر عملکرد رشد، مقاومت در برابر استرس و پاسخ به ایمنی در ماهی سیم دریای سرخ Pagrus major مورد مطالعه قرار دادند و اثرات مثبت آن را نشان داده اند که با این مطالعه دارای تطابق می­باشد(20). در این مطالعه افـزایش وزن روزانه و نهایی هم چنین ضریب رشد ویژه( SGR ) درتیمارهـای دریافـت کننــده باکتری های اسید لاکتیک و پروبیوتیک پریمالاک در مقایســه بــا تیمــار شــاهد افــزایش معنی داری را نشان داد. از آن جاکه بـاکتری هـا مـی تواننـد فعالیت هضم را از طریــق بهبــود فعالیــت هــای آنزیمــی ارتقــا دهنــد، Gatesoup.1999 به همین خاطر مــی تــوان استفاده از باکتری و پریمالاک را عامـل ایـن افزایش شاخص های رشد در ماهی کپور معمولی دانست(13).کلیایی و همکاران در سال 1395 تاثیرsabtilis  Bacillus.از روده ماهی کپور معمولی جدا شده بود را بر روی رشد و بقا همین ماهی مورد بررسی قرار دادند که در شاخص های رشد نتایج مشابهی با این تحقیق به دست آمد(5). مطابق با نتایج این تحقیق میزان WBC خون در هر سه گروه نسبت به گروه کنترل افزایش یافته و بیش ترین افزایش در ارتباط با مصرف پروبیوتیک پریمالاک می باشد. WBC در ماهی عمل فاگوسیتوز را انجام می دهد و در پاسخ های ایمنی بدن نسبت به عوامل انگلی، باکتریایی، ویروسی و کمک به ترمیم بافت های ضایعه دیده نقش مهمی را ایفا می کنند. اندازه گیری گلبول های سفید در تعیین وضعیت عمومی ماهی کاربرد فراوانی می تواند داشته باشد(7). مطابق این تحقیق میزان C3 در ماهیانی که باکتری و پروبیوتیک دریافت کرده بودند دارای افزایش نسبت به گروه شاهد بوده که این امر نشان دهنده افزایش سطح ایمنی در این ماهیان می باشد. امانی نژاد و همکارانش در سال 1388 نشان دادند بیشتر فرم های ترکیبی C3 در ماهیان استخوانی دیده می شود که فرم های ترکیبی C3 تاثیرات پیوندی متفاوتی را در سطوح فعال شده کمپلمان ایجاد می کنند و ماهیان استخوانی با به کار گیری یک روش جدید برای کسب ایمنی ذاتی و نابودی میکروب ها آمادگی بهتری پیدا می کنند. مطابق این تحقیق میزان کورتیزول در هر سه گروه نسبت به گروه کنترل کاهش یافته که کم ترین کاهش را گروه پروبیوتیک پریمالاک نشان می دهد و اختلاف سطح معنی دار مشاهده می شود(05/0>P). کاهش کورتیزول نشان دهنده ی کاهش استرس و ایجاد تعادل فیزیولوژیک در بدن بوده و در رشد بیش تر ماهی موثر است(24). یکی از بهترین شاخص ها جهت ارزیابی وضعیت فیزیولوژیک بدن ماهیان بررسی تغییرات میزان هورمون کورتیزول است. مطابق با نتایج این تحقیق میزان پروتئین تام خون در دو گروه لاکتوباسیل پلانتاروم و پریمالاک نسبت به گروه کنترل افزایش یافته که البته این افزایش دارای سطح معنی داری نبود و بیش ترین افزایش در گروه مصرف روزانه پروبیوتیک بوده است. Zhou et al ., 2010 نشان دادند که استفاده از پروبیوتیک ها باعث افزایش معنی داری در پروتئین تام شده است(30). هم چنین نتایج تحقیقات Sharifuzzamam and Austin, 2010 با یافته های ما مطابقت دارد(34). هم سوی با این نتایج، دیگر محققین از جمله پنیگرهی و همکاران که در سال 2005 تاثیر لاکتوباسیلوس رامنوسوس را بر پاسخ های ایمنی ماهی قزل آلا بررسی کردند و آلدوهیل که تاثیر پروبیوتیک لاکتوباسیلوس اسیدوفیلوس را بر رشد، پارامترهای هماتولوژی و میزان ایمونوگلوبولین در گربه ماهی آفریقایی مورد بررسی قرار داد مشاهده نمود که پروبیوتیک های مذکور باعث افزایش ایمونوگلوبولین گردیدند. افزایش میزان گلوبولین با افزایش میزان پروتئین تام و آلبومین قابل توجیه می باشد. میزان بالای پروتئین سرم در نتیجه ی بهبود عملکرد کبد و دیگر ارگانیسم هایی است که پروتئین پلاسما را می سازند(23). مطابق این تحقیق باکتری های جدا شده دارای تاثیر مثبت بر روند رشد و ایمنی ماهی کپور معمولی بوده اند که سطح آن نسبت به پروبیوتیک پریمالاک که یک پروبیوتیک تجاری و مجموعه ای از چند باکتری است کمتر بوده لذا پیشنهاد می گردد از در تحقیقات آتی از دوز بالاتر این باکتری ها و یا ترکیب این دو باکتری در جیره کپور ماهیان استفاده گردد.

تشکر و قدردانی

بدین وســیله از آقــای دکتر صابر وطن دوست، عضو هیات علمی گروه شیلات دانشگاه آزاد بابل و همـه عزیزانـی کـه در انجـام ایـن تحقیــق این جانــب را یــاری نمــوده انــد کمــال تشــکر و قدردانی را دارم.

منابع
1-استاندارد پروبیوتیک های ایران: شماره (2325). (94).
2-اکبری، ح. 1386. بررسی دلائل کاهش مصرف آبزیان و راه کارهایی برای افزایش مصرف آن، مجله شیلات. سال اول، شماره 3.صفحات 41-36.
3-جعفریان، ح. 1387. توسعه آبزی پروری پایدار با استفاده از پروبیوتیک ها در ایران. مجله شیلات، سال دوم، شماره 4، 56-62.
4-سلطانی،م. 1387. ایمنی شناسی ماهیان و سخت پوستان. انتشارات دانشگاه تهران صفحه 264.
5-کلیائی،ز.، آبرومند، ع.، ضیایی نژاد، س. 1395. تاثیر باکتری زیست یار subtilis . Bacillus مستخرج از روده ماهی کپور معمولی carpio. Cyprinus بر عملکرد رشد و بقاء آن. نشریه توسعه آبزی پروری، سال دهم، شماره دوم، صفحات 99 تا108 .
6-مخیر، ب. 1386. بیماری های ماهیان پرورشی. جلـد دوم، چاپ چهارم، انتشـارات دانشـگاه تهـران،440-500 .
7-وثوقی، غ.، شاهسونی، د.، پیغان، ر. 1376. بررسی فاکتورهای خونی ماهی حوض(Carassius auratus). مجله دامپزشکی دانشگاه تهران، دوره 52. شماره 4 صفحات 70تا 61.
8.Bucio Galindo, A.; Hartemink, R.; Schrama,
 JW., Verreth, JAJ., Rombouts, FM. (2006). Presence of Lactobacilli in the intestinal content of freshwater fish from a river and from a farm with a recirculation system. Food Microbiol., 23; 476-482.
9.Buller, L. (2004). Bacteria from fish and anther aqutic animal, PP; 1-100.
10.Chang-Ho, Kang., YuJin, Shin., YongGyeong, Kim., Jae-Seong, So. (2016). Isolation of Lactobacillus strains from Shellfish for their potential use as probiotics. Biotechnology and Bioprocess Engineering, 21(1); 46-52.
11.Esmaeili Rad, A., Alishahi, M., Ghornbanpour, M., Zarei, M. (2014). The effects of oral administration of extracted chitosan from white leg shrimp (Litopeneaeus vannamei) on heamtological and growth indices in common carp (Cyprinus carpio). Journal of Veterinary Research, 69; 385- 393.
12.Fuller, R. (1989). Probiotics in man and animals . Jurnal Applied Bacteriology, 66; 365-378.
13.Gatesoupe, F.J. (1999). The use of probiotics in Aquaculture. Aquacult., 180; 47-165.
14.Ghelichpour, M., Shabani, A., Shabanpour, B. (2010). Genetic diversity of the two populations of common carp (Cyprinus carpio) in Gharahsu and Anzali regions using eight microsatellite markers. Taxonomy and Biosystematics, 5; 41-48.
15.Ghosh, S., Sinha, A., sahu, C. (2007). Effect of probiotic on reproductive performange in female livebearing ornamental fish. Aquaculture Research, 38; 518-526
16.Hevroy, E.M., Espe, M., Waagbo, R., Sandness, K., Rund, M., Hemer, G.I. (2005). Nutrition utilization in Atlantic salmon (Salmo salar) fed increased level of fish prote hydrolysate during a period of fast growth. Aquacult Nutr., 11, 301-313.
17.Jixing Feng , Deng laiLi, LimingLiu  ,YongzhengTang , Rongbin Du . (2019). Characterization and comparison of the adherence and immune modulation of two gut Lactobacillus strains isolated from Paralichthys olivaceus . Aquacultur, 499; 381-388.
 
18.Kandler, O., Weiss, N. (1986). Genus Lactobacillus beijerinck 1901, 212AL. In: Sneath, PHA; Mair, NS; Sharpe, ME and Holt, JG (Eds.), Bergey’s manual of systematic bacteriology. Vol. 2, Baltimore: Williams and Wilkins. PP;1209-1234.
19.Kissil, G. Wm., Lupatsch, I., Elizur, A., Zohar, Y. (2001). Long photoperiod delayed spawing and increased somatie growth in gilthead seabeam (Sparus aurata). Aquacult, 200; 363-379.
20.Mahmoud, A.O., ShunsukeKoshio, D., Ishikawa, M., Yokoyama, S.(2015).  Effects of heat killed Lactobacillus plantarum (LP20) supplemental diets on growth performance, stress resistance and immune response of red sea bream, Pagrus major , Aquaculture, 442; 29-36.
21.Mathara, J. M., Schillinger, U., Kutima, P. M., Mbugua, S. K., Holzapfel, W. H. (2004). Isolation, identification and characterisation of dominant microorganisms of Kule naoto: the maasai traditional fermented milk in Kenya. International J Food Microbiol, 94(3); 269-278.
22.Mesalhy, A,. Yousef, A., Ahlam, A., Moahmed Fthi, M. (2008). Studies on Bacillus subtilus and Lactobacillus acidophilus potential probiotics, on the immune response and resistence of Tilapia nilotica to challenge infections. Fish and Shelfish Immunology, 25; 128-136.
23.Metwally, M. A. A. (2009). Effect of garlic (Allium sativum ) on som Antioxidnt activites in tilapia nilotica (Orechromis niloticus). World Jornal of the Fish and Marine Science, 1(1); 56-64.
24.Miranda, JM., Vazques, B I.( 2008). Evolution of resistance in poultry intestinal E. coli during three conminly used antimicrobial therapeutic treatments in poultry . Poult . Sci, 87; 1643 – 1648.
25.Mommsen, T, P., Vijaya, M. M., Moon, T. W. (1999). Cortisol in teleosts: dynamics, mechanisms of action, and metabolic requlation. Reviews in fish Biology and Fisheries, 9;211-268.
26.NguyenVan, N., SatoruOnodab,T. (2019). Evaluation of dietary heat-killed Lactobacillus plantarum strain L-137 supplementation on growth performance, immunity and stress resistance of nile tilapia (Oreochromis niloticus) Aquaculture, 498; 371-379.
27.Ojolick, E.J., Cusack, R., Benfey, T.J., Kerr, S.R. (1995). Survival and growth of all female diploid rainbow trout (Oncorhyncus mykiss) reared at chronic high temperature. Aquacult, 131; 177-187 poultry in Iran. J.Poult.Sci. 2007;44(4); 357-65.
28.Ringø, E., Gatesoupe, FJ. (1998). Lactic acid bacteria in fish: a review. Aquaculture, 160; 177-203.
29.Salaghi, Z., Imanpoor, M. R., Taghizadeh, V. (2013). Effect of different levels of probiotic primalac on growth performance and survival rate of Persian sturgeon (Acipenser persicus). Global Veterinaria, 11; 238-242.
30.Salaghi, Z., Imanpoor, M. R., Taghizadeh, V. (2013). Effect of different levels of probiotic primalac on growth performance and survival rate of Persian sturgeon (Acipenser persicus). Global Veterinaria, 11; 238-242.
31.Sharifuzzaman, S. M., Austine, B. (2014). Development of protectiob in rainbow trout (Oncorhynchus mykiss Walbaum) to Vibrio anguillarum following use of the probiotic Kocuria SM1. Fish and Shelfish Immunology, 28; 1-5.
32.Tacon, A.G.J. (1990). Standard methods for the nutrition and feeding of famed fish and shrimp. Argent Laboratories Press., 4-24.
33.Tsai, C. C., Lai, C. H., Yu, B., Tsen, H. Y. (2010). Use of PCR primers and probes based onthe 23S rRNA and internal transcription spacer(ITS) gene sequence for the detection and enumerization of Lactobacillus acidophilus and Lactobacillus plantarum in feed supplements. J.Poult.Sci., 34(4); 357-65
34.Zhou, X., Tian, Z. Wang,Y., Li ,W. (2010). Effect of treatment with probiotics as response .Journal of Fish Physio Biochem, 1(3); 501-509.
35. Zapata, A., Ramirez-Arcos, S. (2015). A comparative study of mcfarland turbidity standards and the densimat photometer to determine bacterial cell density. Curr Microbiol. 70(6); 907-9.