اثر افزودن سطوح مختلف عصاره رازیانه بر میزان باروری مگس سرکه و تاثیر آن بر تراکم پروبیوتیک ها ی موجود در روده آن با تکنیک qReal Time PCR

نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه ژنتیک، دانشکده زیست شناسی، دانشگاه آزاد اسلامی واحد تنکابن، تنکابن، ایران

2 گروه میکروبیولوژی، دانشکده زیست شناسی، دانشگاه آزاد اسلامی واحد تنکابن، تنکابن، ایران.

چکیده

زمینه وهدف: عصاره رازیانه در درمان بسیاری از ناهنجاری های تولید مثلی و ناباروری ها موثر می باشد هدف از تحقیق حاضر افزودن عصاره رازیانه به محیط کشت و بررسی میزان باروری مگس سرکه و تاثیر آن بر تراکم پروبیوتیک ها ی موجود در روده مگس سرکه  از طریق تکنیک ریل تایم می باشد.
روش کار: در تحقیق حاضر از سه غلظت 25، 50 و 75 میکروگرم بر میلی لیتر و گروه فاقد عصاره رازیانه(کنترل) استفاده شد. پارامترهای زمان تاخیر در جفتگیری و طول مدت جفتگیری با کمک کرونومتر اندازه گیری و تعداد تخم ها و تعداد تخم های به دنیا آمده نیز با شمارش آن ها در روی محیط کشت به کمک لوپ صورت گرفت. مگس های سرکه طی دوماه مورد مطالعه قرار گرفتند. جهت بررسی میزان بیان ژن 16SrDNA از qRT-PCR استفاده گردید.
یافته­ها: نتایج تحقیق نشان داد زمانی که از غلظت75 میکروگرم بر میلی لیتردر محیط کشت استفاده شد ، زمان تاخیر در جفتگیری کاهش معنی داری داشته است، هم چنین طول جفتگیری، تعداد تخم ریزی و تعداد تخم های به دنیا آمده به طور معنی داری بیشتر بوده است. نتایج PCR صحت وجود باکتری را تایید نمود و میزان بیان بالایی از ژن مورد مطالعه درباکتری ها مشاهده شد.
نتیجهگیری:با توجه به تحقیق حاضر عصاره گیاه رازیانه بر میزان بیان ژن در پروبیوتیک ها و هم چنین بر میزان باروری مگس ها موثر بوده است.

کلیدواژه‌ها


عنوان مقاله [English]

The Effect of Adding Different Level of Fennel Extracted on the Fertility of Drosophila melanogaster and its Effect on the Density of Probiotics in its Intestine Using Qreal-Time PCR Technique

نویسندگان [English]

  • Masood Ghane 2
  • sheida Akhshabi 1
2 Department of Biological Sciences, Faculty of Microbiology, Islamic Azad University Tonekabon Branch, Iran
چکیده [English]

I
Inroduction & Objective:The aim of this study, was additive extraxted fennel in the medium  for increasing  reproductive performance, concentration of probiotices by using qRT-PCR technique.
Materials and Methods:In the present study, fennel extracted was divided into different concentrations. Concentrations including 25, 50 and 75 µg /ml were added to the culture medium. In addition, a control sample was used to confirm the results. Parameters of mating latency and copulation duration, was measured by coronometr instrument. Fecundity and fertility also were count by Loop on the medium. The flies were studied for two months.
Results: In this study, concentration of 25,50,75 µg/ ml and control group was used.  The results showed concentration of 75µg/ml was significant decreasing mating latency and increasing copulation duration, fecundity and fertility parameters were showed. Moreover were confirmed lactobacilus brevis by PCR technique  In addition using qRT-PCR technique and confirmed higher expression in 16srDNA when used 75µg/ml concentration.
Conclusion: According to the present study, the higher fennel extracted  has been effective on gene expression in probiotics and also on the reproductive performance of flies showed.

کلیدواژه‌ها [English]

  • Drosophila melanogaster
  • probiotics
  • Fennel extraction
  • expression

گیاه رازیانه Foeniculum vulgare (FVE) یا Fennel یک گیاه شناخته شده داروئی منطقه مدیترانه است(33). میوه FVE دارای سابقه طولانی در استفاده به عنوان غذا و دارو مصرف می باشد. به طور سنتی، اعتقاد بر این است که این گیاه به عنوان یک نیروی گرانشی(کمک به کنترل نفخ شکم) و افزایش تولید شیر مادر عمل می کند. محققین گزارش نموده اند که این گیاه هم چنین می تواند افزایش میل جنسی، تسریع تولد، تسکین علائم بالینی مردان، ترویج جریان قاعدگی و تسکین معده و سرفه موثر باشد. ترکیبات دانه رازیانه شامل ترانس آنتول، استراگوئل، فنچون و α-phellandrene بوده و غلظت نسبی این ترکیبات به طور قابل توجهی بسته به وضعیت فنولوژیکی و منشاء گیاه متفاوت است. رازیانه از دیرباز به عنوان یک عامل استروژنی با سمیت کم و عدم وجود سرطان زایی به معرفی شده است، بنابراین می توان آن را مجدداً به کاربرد پزشکی مدرن معرفی کرد. علاوه بر این خواص  ضد التهابی، ضد دیابتی، ضد توموری و بسیاری از فعالیت های دیگر این گیاه در مطالعات مختلف نشان داده شده است(1). این گیاه به عنوان یک عامل استروژنی با سمیت کم و عدم وجود سرطان زایی مستند است. مطالعه نشان داده که عصاره دانه رازیانه در غلظت 100 و 200 میلی گرم بر کیلوگرم می تواند تعداد فولیکول های مختلف تخمدان را به طور چشمگیری افزایش دهد(23، 10). در سال های اخیر، استفاده از داروهای جایگزین، به ویژه داروهای گیاهی، به دلیل کمبود عوارض جانبی و کاهش هزینه ها به طور گسترده در درمان ناباروری مورد توجه قرار گرفته است(18). روغن رازیانه حاوی ترکیبات مختلف مانند آنول یا دی متیلیدانتوئل است که ممکن است دارای فعالیت استروژنیک باشد. یکی دیگر از اجزای این روغن دانه، فلاونوئیدها است که یک نوع فیتواستروژن می باشد. بعضی از مطالعات عمل استروژنیک فیتواستروژن ها را در شرایط in vivo و in vitro نشان می دهد(6). در مطالعه دیگری گزارش شده است که رازیانه می تواند شدت دیسمنوره را کاهش دهد و در مطالعه دیگری گزارش شده است که رازیانه اثری مشابه با مفنامیک اسید در کاهش درد دیسمنوره دارد (33) . مطالعات نشان داده که عصاره رازیانه در غلظت های مختلف 100 و 200 میلی گرم در کیلوگرم سطح هورمون های استروژن و پروژسترون خون موش ها به میزان معنی داری افزایش می دهد. مگس سرکه امروزه کاربرد فراوانی در تحقیقات ژنتیک دارد. در خصوص مگس نر، غدد جنسی فعال یکی از عوامل مهم درمیزان باروری مگس نر می باشد. ساختار آن به صورت یک لایه سلولی که این غدد با تولید پروتئین ها(Accessory gland proteins(Acps))، کربوهیدرات ها و لیپیدها که در حین جفت گیری با مگس ماده همراه با اسپرم منتقل می شود(27، 21، 20، 16، 11). حدود 25 تا 150 پروتئین مختلف در غدد جنسی مگس نر تولید می شود. سایز غدد، تعداد سلول ها و سایز سلول ها در میزان ترشح، کیفیت و کمیت ترشح پروتئین ها موثر است(9). Bertram و همکاران سال 1993، پیشنهاد نمودند که تغییرات در Acp ها در میزان عملکرد تولیدمثلی مگس های نر موثر می باشد. علاوه بر آن Acp ها نقش به سزایی در عملکرد تولیدمثلی مگس ماده از نظر میزان تخمگذاری(Fecundity)، تعداد تخم­های تبدیل شده به لارو(hatchability) و تعداد مگس های بالغ(offspring produced) دارند (13). هم چنین Acp ها علتی برای افزایش تولید اسپرم، افزایش حرکت اسپرم ها(sperm motility) داشته اند(16، 14، 13، 3). پروبیوتیک ها امروزه کاربرد فراوانی در صنایع غذایی،دارویی و کشاورزی دارد. امروزه دانش پروبیوتیک افزایش یافته و در حال حاضر این میکروارگانیسم ها از طریق اصلاح میکرب های مضرروده، ترشح مواد ضد باکتریایی(باکتریسیت ها و اسیدهای آلی)، رقابت با پاتوژن ها برای جلوگیری از چسبیدن آن ها به روده، رقابت برای مواد مغذی لازم برای زنده ماندن پاتوژن و ایجاد یک اثر آنتی توکسین است. به نظر می رسد باکتری های پروبیوتیک به عنوان مکمل های غذایی مورد استفاده قرار می گیرند. اکثر پروبیوتیک ها به عنوان مکمل های زنده در رژیم غذایی عرضه می شوند که توانایی عبور از مسیر روده را دارد(16). با توجه به این که یکی از روش های سنجش کمیت تراکم باکتری ها روش RT-PCR می باشد و تحقیق حاضر هدف بررسی کمیت پروبیوتیک ها با توجه به تغذیه مگس ها از عصاره رازیانه است. تحقیقات مختلفی در این خصوص صورت گرفته است. محققین روش های هیبریداسیون DNA و سطح آستانه کل DNA را جهت اندازه گیری کمی DNA ژنومی باکتری E Coli با روش RT-PCR مقایسه کردند که در آن حساسیت و دقت روش RT-PCR ،30 برابر بالاتر از دو روش دیگر ذکر شد(27، 21، 20، 17). پروبیوتیک ها علاوه بر این که در تولید ویتامین های مختلف روده دخالت دارند در تولید پروتئین های مختلف نیز نقش موثری ایفا می کنند. تحقیقات مختلفی آن را به اثبات رسانده است. پروتئین خام و محتوای چربی در تمام مواد غذایی مورد آزمایش با مقادیر توصیه شده(پروتئین خام 30 و 45٪ و چربی خام 4 و 8٪) بود. پیوستن زیست توده باکتریایی به پایه خوراکی احتمالاً سبب افزایش محتوای پروتئین همه پروبیوتیک های خوراکی(T1، T2، T3 و T4) نسبت به جیره غذایی تحت کنترل می باشد. نتایج یک تحقیق بر روی ماهی سالمون نشان داد که ماهی هایی که تحت تیمار جیره غذایی با پروبیوتیک ها بودند در مورد ماهی های ماده افزایش تخم ریزی و افزایش تعداد لاروهای بیرون آمده از تخم ها(Hatchability) مشاهده شد(4). در خصوص ارتباط بین افزایش باروری مگس سرکه و مصرف رازیانه و نقش پروبیوتیک ها در آن تاکنون در مقالات مختلف گزارش نشده است. باکتری ها بخش عمده فلور روده را به خود اختصاص داده اند، به طوری که 35 تا50 درصد قولون(روده بزرگ) از باکتری ها تشکیل یافته است.60درصد توده مدفوع را باکتری ها تشکیل می دهند. چیزی حدود 300 تا 1000 گونه میکروارگانیسم مختلف در روده ها زیست می کنند. مخمرها نیز بخش کوچکی از این فلور را به خود اختصاص داده اند. 400 تا 800 گونه باکتری در روده ها به سر می برند(17). امروزه پروبیوتیک ها باعث افزایش محافظت سیستم دستگاه گوارشی علیه میکرب­های مضر هستند. در مورد دروزوفیلا نیز تاکنون به اثبات رسیده است که دارای یک سری باکتری های مفید در روده آن هاست که آن ها را در برابر آلودگی­های قارچی و میکروبی محافظت می کند. ظاهراً این پروبیوتیک ها در محیط کشت دروزوفیلا نیز مشاهده شده است(4). از دیرباز وجود پروبیوتیک ها در روده مگس سرکه به اثبات رسیده است(21). معمولاً پروبیوتیک های موجود در روده مگس سرکه از جنس لاکتوباسیلوس(ﻻﻛﺘﻮﺑﺎﺳﻴﻠﻮس ﭘﻼﻧﺘﺎروم) هستند که آن­ها را از آلودگی به بسیاری از میکروب ها و قارچ ها از جمله قارچ آسپرژیلوس ممانعت می کند(27). در این ارتباط از بین گیاهان مختلف عصاره رازیانه در درمان بسیاری از ناهنجاری های تولید مثلی و ناباروری­ها موثر می باشد(4). این گیاه به دلیل وجود مواد تراتوژنیک به همراه عصاره محیط کشت مگس سرکه در افزایش باروری موثر خواهد بود. به طور کلی با فرض این که عصاره رازیانه به عنوان یک گیاه که در افزایش باروری موثر است چه مقدار می تواند در جمعیت میکروبی روده مگس سرکه تاثیرگذار باشد و در نهایت آیا می تواند باعث افزایش کیفیت محیط کشت و در نهایت بر باروری بیشتر مگس ها منجر گردد. روده حاوی انواع بسیاری از باکتری ها (مفید، مضر وخنثی) است که باید توازن باکتری های روده در بدن برقرار باشد در غیر این صورت علاوه بر مختل شدن وظایف فلور روده باعث آکنه، آلرژی غذایی، خستگی مفرط، افسردگی، سردرد و غیره می شود. البته لازم به ذکر است که در افراد سالم باکتری های مفید غالب هستند. درون دسـتـگاه گـوارش هـمـه جانوران این فلور روده ای وجـود دارد. جانورانی که کاملاً در شرایط بـدون بـاکـتری پرورش می یابند، بیش از جانوران عادی که  فـلور روده آنـ هـا شـکــل گـرفـتـه اســت، آسیب پـذیـرتر هســتند. ترکیب فلور روده هـر جانور، ویـژه ی هـمان جـانـور است(5). Apidianakis و همکاران سال 2011 بر عملکردپروبیوتیک ها در دروزوفیلا بررسی انجام دادند، در این تحقیق باکتری­های Klebsseila، Bacillus و مخمر Candida از روده دروزوفیلا استخراج شدند، این اجرام به محیط کشت اضافه شدند هم زمان از باکتری ایزوله شده نظیر Bacillus subtilis و Bacillus cereus که منبع رشد آن ها از بوقلمون و مرغ بودند استفاده شد. این باکتری­ها گزارش شده بودند که به عنوان پروبیوتیک در کاهش جمعیت آسپرژیلوس و سایر عفونت های گوارشی موثر است. به طور کلی هدف از این تحقیق تاثیر پروبیوتیک ها بر کیفیت محیط کشت که در این تحقیق مطالعه بر روی میزان باروری است می باشد(5). Forester و همکاران سال 2011 و Fujiki وهمکاران سال 2015، نشان دادند که عصاره های به دست آمده از برگ های رازیانه قادر است فشارخون سرخرگی را بدون آن که بر تعداد ضربات قلب یا تنفس تأثیر داشته باشد، به طور چشمگیری کاهش دهد. ازطرفی مطالعات نشان داد که عصاره گیاه رازیانه ازطریق گیرنده های سروتوژنیک و مهار آنتاگونیست های هیستامینی منجر به کاهش فشارخون و جریان خون به داخل بیضه می شود. در تحقیقی هم تأثیر رازیانه بر کاهش خون مشخص شده است. احتمال دارد که عصاره رازیانه با مکانیسم فوق، باعث کاهش فشار خون و جریان خون به داخل بیضه و در نتیجه کاهش تستوسترون شود. یکی از متغیرهای دیگر در این تحقیق تاثیر عصاره رازیانه در باروری دروزوفیلا می باشد. عصاره بعضی از گیاهان خصوصاً رازیانه به عنوان یک آنتی اکسیدان فعال در دروزوفیلا عمل می نماید. علاوه بر آن این عصاره در جلوگیری از موتاسیون سلول ها و ایجاد سلول های غیر نرمال در دروزوفیلا ممانعت می کند(19، 8). در تحقیق حاضر اهداف مختلف از جمله

1-     بررسی جمعیت پروبیوتیک های محیط کشت مگس سرکه و افزایش باروری مگس ها زمانی که در محیط کشت مگس از غلظت های مختلف عصاره رازیانه استفاده شده است.

2-      تاثیر پروبیوتیک ها در افزایش عملکرد تولید­مثلی هنگامی که از عصاره رازیانه استفاده می شود، می باشد.

3-     بررسی تاثیر مصرف سطوح مختلف عصاره رازیانه بر میزان باروری مگس سرکه که در نهایت بر جمعیت پروبیوتیک های موجود در روده آن اثرگذاری نماید.

به طور کلی هدف اساسی از تحقیق حاضر افزایش میزان باروری مگس سرکه به کمک عصاره رازیانه موجود در محیط کشت و هدف فرعی وضعیت پروبیوتیک های موجود در محیط کشت و در واقع تغییراتی که در محیط کشت ایجاد می شود با تجزیه و تحلیل به کمک دستگاه های مرتبط است.

مواد و روش ها

عصاره گیری به روش ماسراسـیون طبـق تحقیقـات گذشـته انجام شد(در این روش ابتدا اندام هوایی گیاهان به صورت خشک توسط ترازوی دیجیتال به میزان پنجاه گرم توزین شدندو پس از پودر کردن آن ها درون ارلن قرار گرفته و روی هر نمونه 1000 سی سی از حلال(50درصد اتانول 96% و 50درصد آب) ریخته تا کاملاً پودر را بپوشاند. بعد از پوشاندن سر ارلن ها با ورقه آلومینیومی به مدت 48 ساعت بر روی دستگاه شیکر با نود دور در دقیقه قرار گرفتند. بعد از این که حلال و گیاه همگن شدند محلول ها توسط کاغذ صافی واتمن صاف و محلول روی بن مـاری قـرار داده شـد تا حلال از عصاره خارج شود. پس از تبخیر حلال، عصاره خشک حاصل شد، که به ازای هر 100 گرم رازیانه، 14 گرم عصاره به دست آمد)(2، 1). مقادیر مورد نیاز از عصاره، بـه کمـک ترازوی حساس 001/0 میلی گرمی توزین و در مقدار معینی از محیط کشت حل شد تا عصاره با غلظت مورد نیاز بـه دسـت آید

 اضافه نمودن عصاره گیاه به محیط کشت مگس سرکه

در این ارتباط عصاره رازیانه با غلظت های 25، 50و 75 میکروگرم بر میلی لیتر(25 میکروگرم عصاره پودر شده با 1 سی سی آب) به محیط کشت مگس اضافه و تاثیر آن در میزان باروری مگس سرکه مورد بررسی قرار گرفت(2). با توجه به نسبت 100 گرم گیاه رازیانه 14 گرم عصاره خشک حاصل می شود، نسبت زیر در تحقیق حاضر استفاده شد. با توجه به نسبت 100 گرم برای 14گرم، 179 گرم برای 25 گرم عصاره خشک مورد نیاز است همین طور برای سایر غلظت ها رعایت شد(2).

نمونه لازم شامل مگس های بالغ.

ابتدا مواد لازم برای تهیه محیط کشت شامل آرد گندم، ساکارز، مخمر ، عصاره رازیانه را با آب به مقدار معین حرارت داده سپس زمانی که دمای محیط کشت به زیر 60 درجه رسید اسید پروپیونیک به محیط کشت اضافه میشود. در ارتباط با غلظت های مختلف عصاره رازیانه از غلظت های 25، 50 و 75 میکروگرم بر میلی­لیتر به همراه گروه شاهد که فاقد عصاره گیاه رازیانه بود استفاده شد. ویال ها حاوی محیط کشت هر 10 تا 15 روز عوض شده و مگس ها به محیط کشت جدید پاساژ داده شدند.

بررسی میزان باروری مگس های بالغ ماده

در خصوص مگس های بالغ ماده، میزان تخم ریزی آن ها مورد بررسی قرار گرفت. در این ارتباط به کمک میکروسکوپ نوری با بزرگ نمایی 10 میزان تخم های گذاشته شده در داخل ویال های آزمایشگاهی شمارش گردید. هم چنین تعداد مگس ها(نتاج) نیز با شمارش تعداد مگس های بیرون آمده از تخم به طور روزانه در ویال ها شمارش شدند. ب

بررسی محیط کشت مگس سرکه از نظر وجود و میزان فعالیت پروبیوتیک ها در آن به عنوان شاخص مورد بررسی در این مطالعه

 در این ارتباط ترکیبات محیط کشت در حالت بدون استفاده از عصاره رازیانه و با استفاده از عصاره رازیانه تحقیق انجام شد. در هر دو مورد ذکر شده به کمک روش PCR وجود پروبیوتیک ها مورد بررسی قرار گرفتند.

انجام فرایند PCR :

 با توجه به غلظت های استاندارد شده در مورد DNA الگو،(dNTP)، آغازگرها وTaq DNA Polymerase، واکنش زنجیره ای پلیمراز با دستگاه Eppendorf Gradient انجام شد، بهینه سازی شرایط PCR با انجام تغییرات در غلظت های DNA الگو، تغییر دادن دمای اتصال با انجام برنامه دمایی گرادیانت و هم چنین غلظت آغازگرها و تعداد چرخه های واکنش و زمان گسترش در واکنش PCR صورت گرفت(جداول 1 و 2).

طراحی پرایمر

 طراحی پرایمر به منظورتهیه DNA و تعیین توالی ژن 16 S rDNA مربوط به باکتری Lactobacillus brevisصورت گرفت در ابتدا به وسیله برنامه کامپیوتری DNAMAN و با توجه به اطلاعات توالی مربوط به ژن مورد نظرکه در بانک جهانی ژن وجود داشت صورت گرفت. برای این کار جفت پرایمر زیرتقریباً از ابتدا تا انتهای ژن طراحی گردید و یک قطعه به طول 300 جفت بازی تکثیر می گردد

 بررسی محصول PCR

روشی که بررسی محصولات PCR را به طور کیفی یا کمی از نظر وجود یا عدم وجود و یا مقدار تولید محصول را با استفاده از آن مورد ارزیابی قرار می دهد الکترو فورز محصول PCR در ژل آگارز است. غلظت­های مختلفی از این ژل جهت بررسی DNA مورد نظر، استفاده می شود که این غلظت ها معمولاً بین 5/0 تا 5 درصد می باشد. در اینجا از غلظت1 تا5/1 درصد استفاده گردید.

انجام RT-PCR

در این خصوص جهت بررسی بیان ژن 16srDNA استخراج RNA از باکتری بــه منظـور بررســی بیـان ژن­های 16srRNA  و GAPDH پس از تیمار با غلظت­های مختلف رازیانه و کنترل صورت گرفت. استخراج RNA توسط دستورالعمل تهیه شده از شرکت کیاژن، آمریکا انجام گرفت. غلظت RNA مورد استفاده حدود 1 تا 2 میکروگرم در نظر گرفته شد. ساخت cDNA از روی RNA استـــخراج شده، پـــس از تعیین مقدار و غلظت RNA حاصل از ســـلول های باکتری توسط دستـــگاه نانـــودراپ، مطـــابق با کیــت فرمنــــتاز TAKARA First Strand cDNA Synthesis Kit انجام گرفت. RT-PCR در حجم نهایی 20 میکرولیتر شامل، 10میکرولیتر Syber Green، پرایمر های پیشرو و معکوس(۱۰ پیکومولار) هر کدام به حجم 5/0 میکرولیتر و cDNA به حجم 2 میکرولیتر که در نهایت با آب عاری از نوکلئاز به حجم مورد نظر رسانده شد. پرایمرهای لازم برای ژن های ساختمانی شامل:

 GAPDH Forward       GGAAGGTGAAGGTCGGAGTCA

GAPDH Reverse    GTCATTGATGGCAACAATATCCAC

 

جدول 1- ترکیبات PCR که به حجم 25 میکرولیتر

نوع محلول

حجم بافر (میکرولیتر)

نمونه DNA((100ng/µl))

3

پرایمر فوروارد(100pmol)

AGAGTTTGATCMTGGCTCAG

5/0

(100pmol) پرایمرریورس

GGTTACCTTGTTACGACTT

5/0

مخلوط dNTP (2.5mM)

1

بافر 10X

5/2

MgCl2

2

آنزیم Taq (3U/ µl)

5/0

آب دوبار تقطیر

15

25 میکرولیتر

حجم نهایی

 

جدول2- پروفایل دمائی و سیکل برنامه انجام PCR مربوط به ژن 16SrDNA

94°C

95°C

55/5°C

72°C

72°C

5 min

30 sec

40 sec

30sec

10 min

 

40 cycles

 

 

هم چنین در مطالعه فوق ازدستگاه ABI ساخت شرکت آمریکا استفاده و برنامه دمایی دستگاه در سه مرحله انجام شد. مرحله اول که منجر به دناتوره شدن DNA الگو و فعال شدن آنزیم پلیمراز می گردد، در دمای 95 درجه سانتی گراد و به مدت یک دقیقه انجام گرفت. در مرحله دوم، واکنش تکثیری DNA در40 سیکل و با دمای 95 درجه سانتی گراد به مدت 20 ثانیه و دمای 60 درجه سانتی گراد به مدت 35 ثانیه ادامه یافت. مرحله پایانی جهت ترسیم منحنی تفکیک یا منحنی ذوب به صورت95 درجه سانتی گراد به مدت 15 ثانیه، 60 درجه سانتی گراد به مدت 30 ثانیه و 95 درجه سانتی گراد به مدت 15 ثانیه انجام شد. به منظور تأیید قطعه تکثیر شده و اطمینان از عدم وجود محصول غیر اختصاصی، آغازگر دایمر و آلودگی، منحنی تفکیک مورد بررسی قرار گرفت. پس از تکثیر، Ct نمونه ها شناسایی شده و بر اساس روشRelative Quantification (RQ) و فرمول -ΔΔCT 2 میزان بیان ژن 16srDNA در مقایسه با ژن داخلی(GAPDH) به دست آمد. جهت انجام واکنش  Real Time PCRابتدا پرایمرهای ژن 16srDNA و GAPDH با استفاده از نرم افزار oligo نسخه 7 و اطلاعات ژن در Bank Gene طراحی گردید. سپس جهت اطمینان پرایمرها در NCBI،Blast شد. نتایج با کمک نرم افزار آماری SPSS نسخه 16 تجزیه و تحلیل و از روش های آماری تکمیلی مثل آزمون واریانس یک طرفه ANOVA استفاده شد. آزمون تعقیبی TUKEY در سـطح اطمینان ٩٥ درصـد انجام شـد. تفاوت ها در صـورتی که٠٥/٠ ≤p باشد معنی دار در نظر گرفته شد.

نتایج

جمع آوری و پرورش مگس های ماده

در تحقیق حاضر جهت بررسی تاثیر عصاره گیاه رازیانه در افزایش باروری مگس ها ، پرورش مگس سرکه در ویال های 10 سی سی انجام شد. در این ارتباط مگس ها به دوگروه کنترل(بدون عصاره رازیانه)، محیط کشت حاوی عصاره رازیانه تقسیم بندی شدند. در این ارتباط میزان باروری مگس های ماده زمانی که در گروه کنترل و گروه تحت تیمار عصاره رازیانه بودند مورد ارزیابی قرار گرفتند. پارامترهای مورد ارزیابی شامل مدت زمان تاخیردرجفت گیری(Mating latency) ، طول زمان جفت گیری(Copulation duration)، تعداد تخم های گذاشته شده(Fecundity)و تعداد مگس های به دنیا آمده (Fertility)بودند. در نمودار 1 نتایج نشان داد که مدت زمان تاخیر در جفت گیری، در تیمار دهی بعد از مصرف عصاره رازیانه و کنترل به ترتیب 75، 50 و 25 میکرو گرم بر میلی لیتر که بعد از تیماردهی با رازیانه زمانی که از مقدار 75 میکرو گرم بر میلی لیتر استفاده شد کمتر از گروه کنترل بوده است(19/19، 21/18، 32/15و 92/13 به ترتیب برای گروه کنترل، 25، 50 و 75 میکروگرم بر میلی لیتر است). علاوه بر آن درخصوص طول مدت جفتگیری در مگس سرکه نیز نتایج نشان داد زمانی که از تیمار عصاره رازیانه با غلظت 75 میکروگرم بر میلی لیتر استفاده شد طول مدت جفت­گیری نیز بالا بود و (92/25، 32/22، 34/21،22/20 دقیقه، به ترتیب برای بیشترین غلظت مصرف رازیانه تا گروه کنترل ،بودند)(نمودار 2). هم چنین میزان تخم­ریزی نیز زمانی که از غلظت 75 میکروگرم بر میلی لیتر استفاده شد بالا بود(399، 363، 345، 334 به ترتیب در بالاترین مصرف عصاره تا گروه کنترل)(نمودار 3). علاوه بر آن نتایج تعداد تخم های بیرون آمده نیز زمانی که از غلظت 75 میکروگرم بر میلی لیتر استفاده شد بیشتر از زمانی که از غلظت 25 میکروگرم بر میلی لیتر و گروه کنترل استفاده شد بود بوده است(174، 183، 198، 224 ) (نمودار 4).علاوه برآن با برنامه SPSS آنالیزOne Way-ANOVA تمامی پارامترهای مربوط به باروری مورد بررسی قرار گرفت و تاثیر معنی دار را به جز در طول مدت جفت گیری بین مصرف بیشتر رازیانه(75 میکروگرم برمیلی گرم) نسبت به گروه کنترل(گروه فاقد رازیانه) داشته است(نمودارهای 1 تا 4). با توجه به این که پارامترهای باروری در مگس سرکه ماده شامل تاخیر در جفت گیری، طول جفت گیری، میزان تخم ریزی، تعداد تخم های به دنیا آمده به طور روزانه شمارش می-گردید از روش رگرسیون استفاده شد. نتایج نشان داد که تاثیر غلطت عصاره رازیانه در تاخیر جفتگیری در مگس سرکه(سطح 1(75 میکروگرم بر میلی لیتر)، سطح 2(50 میکروگرم بر میلی لیتر)، 3(25 میکرو گرم بر میلی لیتر) و 4(گروه کنترل). همان طور که در نمودار 5 مشخص شده است. در غلظت 75 میکروگرم تجمع نقاط بیشتر که نشان دهنده تاثیر غلظت بالا درکاهش تاخیر در جفت­گیری است. هم چنین در خصوص طول مدت جفت­گیری نیز با روش رگرسیون مورد بررسی و نتایج نشان داد که سطح 1(75 میکروگرم بر میلی لیتر)، سطح 2(50 میکروگرم بر میلی لیتر) ، 3(25 میکرو گرم بر میلی لیتر) و 4(گروه کنترل) است. همان طور که مشخص شده است در غلظت 75 میکروگرم تجمع نقاط بیشتر که نشان دهنده تاثیر غلظت بالا درافزایش طول جفت گیری است (نمودار 6). درخصوص تعداد تخم ریزی نیز با روش رگرسیون مورد بررسی قرار گرفت(سطح 1(75 میکروگرم بر میلی لیتر)، سطح 2(50 میکروگرم بر میلی لیتر) ، 3(25 میکرو گرم بر میلی لیتر) و 4(گروه کنترل). همان طور که مشخص شده است، در غلظت 75 میکروگرم تجمع نقاط بیشتر که نشان دهنده تاثیر غلظت بالا درافزایش طول جفت­گیری است (نمودار 7). نتایج تعداد تخم های به دنیا آمده نیز نشان دهنده تاثیر بالای غلظت عصاره رازیانه در میزان تخم های به دنیا آمده داشته است. در این ارتباط(سطح 1(75 میکروگرم بر میلی لیتر)، سطح 2(50 میکروگرم بر میلی لیتر) ، 3(25 میکرو گرم بر میلی لیتر) و 4(گروه کنترل) می باشد. همان طور که مشخص شده در غلظت 75 میکروگرم تجمع نقاط بیشتر که نشان دهنده تاثیر غلظت بالا در درافزایش تخم های به دنیا آمده(هچ شده) است(نمودار8). در جدول 1 نتایج نشان داد که همبستگی بین میزان مصرف عصاره رازیانه و پارامترهای مرتبط با باروری در مگس سرکه ماده شامل مدت زمان تاخیر در جفت گیری، طول زمان جفت گیری، تعداد تخم های گذاشته شده و تعداد مگس های به دنیا آمده وجود دارد و اثرات معنی دار بودن در همبستگی بین پارامترها مشاهده شده است.

نتایج PCR

در تحقیق حاضر به منظور شناسایی باکتری های باسیلوس برویس موجود در محیط کشت مگس سرکه استخراج DNA انجام شد. PCR بر روی ژل آگارز 1.5 درصد ران شد(شکل 1). همان طور که در شکل مشاهده می شود 26 نمونه از محصولات PCR که جهت بهینه سازی از کیفیت های مختلف برخودار هستند، مورد بررسی قرار گرفتند.

نتایج آنالیز RT-PCR

در تحقیق حاضر به منظور بررسی میزان بیان ژن 16SrDNA باکتری لاکتوباسیلوس برویس qRT-PCR انجام و در نمودار های 9-11 نتایج آنالیز نمودارهای حاصل از واکنش qRT-PCR نشان داده شده است. تعداد 20 نمونه مورد بررسی قرار گرفت. میزان بیان ژن 16SrDNA در جیره تحت کنترل به ترتیب کمتر از زمانی که از غلظت 25، 50 و 75 میکرو گرم بر میلی گرم می باشد بود. که در زیر به صورت عددی مشخص گردیده است.

 

جدول 1-همبستگی بین میزان مصرف عصاره رازیانه و پارامترهای مرتبط با باروری در مگس سرکه  ماده شامل مدت زمان تاخیر در جفت گیری، طول زمان جفت گیری، تعداد تخم های گذاشته شده و تعداد مگس های به دنیا آمده.

Parameters

 

Ages

 

Mating latency

Copulation duration

Fecundity

Fertility

Fennel

1

 

 

 

 

 

Mating latency

-.233**

1

 

 

 

Copulation duration

.179*

.080

1

 

 

Fecundity

-.632**

.140

-.092

1

 

Fertility

-.547**

.290**

.007

.543**

1

 

 

نمودار1- نتایج مصرف عصاره رازیانه در غلظت های مختلف 25، 50 و 75 میکروگرم بر میلی لیتر گروه کنترل

. همان طور که در نمودار مشخص شده غلظت 25 میکروگرم، میانگین تاخیر در جفت گیری بیشتر بوده است.

 

 

نمودار2-نتایج مصرف عصاره رازیانه در غلظت های مختلف 25، 50 و 75 میکروگرم بر میلی لیتر و گروه کنترل.

همان طور که در نمودار مشخص شده غلظت 75 میکروگرم، طول جفتگیری بیشتر بوده است.

 

 

 

نمودار 3-نتایج مصرف عصاره رازیانه در غلظت های مختلف 25، 50 و 75 میکروگرم بر میلی لیتر و گروه کنترل.

همان طور که در نمودار مشخص شده غلظت 75 میکروگرم، تعداد تخم های بیشتری گذاشته شده است.

 

 

 

نمودار4- نتایج مصرف عصاره رازیانه در غلظت های مختلف 25، 50 و 75 میکروگرم بر میلی لیتر و گروه کنترل.

همان طور که در نمودار مشخص شده غلظت 75 میکروگرم تعداد تخم های هچ شده بیشتر بوده است.

 

 

 

 

 

نمودار5- آنالیز رگرسیون خطی تاثیر غلطت عصاره رازیانه در تاخیر جفتگیری در مگس سرکه (سطح 1(75 میکروگرم بر میلی لیتر)، سطح 2(50 میکروگرم بر میلی لیتر) ، 3(25 میکرو گرم بر میلی لیتر) و 4(گروه کنترل).  

همان طور که در نمودار مشخص شده است. در غلظت 75 میکروگرم تجمع نقاط بیشتر که نشان دهنده تاثیر غلظت بالا درکاهش تاخیر در جفت گیری است.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار6- آنالیز رگرسیون خطی تاثیر غلطت عصاره رازیانه در طول جفتگیری در مگس سرکه (سطح 1(75 میکروگرم بر میلی لیتر)، سطح 2(50 میکروگرم بر میلی لیتر) ، 3(25 میکرو گرم بر میلی لیتر) و 4(گروه کنترل).  

همان طور که در تصویر مشخص شده است. در غلظت 75 میکروگرم تجمع نقاط بیشتر که نشان دهنده تاثیر غلظت بالا درافزایش طول جفت گیری است.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار7- آنالیز رگرسیون خطی تاثیر غلطت عصاره رازیانه در طول جفتگیری در مگس سرکه

(سطح 1(75 میکروگرم بر میلی لیتر)، سطح 2(50 میکروگرم بر میلی لیتر) ، 3(25 میکرو گرم بر میلی لیتر) و 4(گروه کنترل).

همان طور که در تصویر مشخص شده است. در غلظت 75 میکروگرم تجمع نقاط بیشتر که نشان دهنده تاثیر غلظت بالا درافزایش طول  جفت گیری است.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار8-آنالیز رگرسیون خطی تاثیر غلطت عصاره رازیانه درافزایش تخم های به دنیا آمده(هچ شده)در مگس سرکه (سطح 1(75 میکروگرم بر میلی لیتر)، سطح 2(50 میکروگرم بر میلی لیتر) ، 3(25 میکرو گرم بر میلی لیتر) و 4(گروه کنترل).

همان طور که در تصویر مشخص شده است. در غلظت 75 میکروگرم تجمع نقاط بیشتر که نشان دهنده تاثیر غلظت بالا در درافزایش تخم های به دنیا آمده(هچ شده) است.

 

 

 

 

 

 

 

 

 

 

 

 

.

شکل1-نتایج محصول PCR مربوط به ژن 16SrDNA باکتری باسیلوس برویس.

همان طور که در شکل مشاهده می شود 26 نمونه از محصولات PCR که جهت بهینه سازی از کیفیت های مختلف برخودار هستند، مورد بررسی قرار گرفتند. سایز خط کش ژنی 300 جفت بازی می باشد.

25µg/ml= 0.000445>0.0000826

50µg/ml= 0.000474>0.0000826

75µg/ml= 0.000499>0.0000826

 

 

شکل 9- بررسی تاثیر مصرف عصاره رازیانه (25میکروگرم بر میلی لیتر) بر میزان بیان ژن 16srDNA باکتری لاکتوباسیلوس برویس نسبت به گروه کنترل بیشتر می باشد.

 

 

شکل 10- بررسی تاثیر مصرف عصاره رازیانه (50میکروگرم بر میلی لیتر) بر میزان بیان ژن 16srDNA باکتری لاکتوباسیلوس برویس نسبت به گروه کنترل بیشتر می باشد.

 

شکل 11- بررسی تاثیر مصرف عصاره رازیانه (75میکروگرم بر میلی لیتر) بر میزان بیان ژن 16srDNA باکتری لاکتوباسیلوس برویس نسبت به گروه کنترل بیشتر می باشد.

 

بحث و نتیجه­گیری

 

پروبیوتیک‌ها باکتری‌های خوب دستگاه گوارش به ویژه معده و روده هستند، این باکتری‌ها در حین فرآیند هضم زنده می‌مانند، برای سلامتی بسیار مفید هستند و با تقویت سیستم ایمنی بدن، جذب مواد مغذی و حفاظت در برابر اختلالات گوارشی، از امراضی مانند سندرم روده تحریک‌پذیر جلوگیری می‌کنند. در حیوانات نیز وجود پروبیوتیک ها در دستگاه گوارش بسیار پراهمیت است. وجود پروبیوتیک ها در دستگاه گوارش حیوانات باعث افزایش رشد جوجه های گوشتی، افزایش تولید تخم مرغ و در دام ها باعث افزایش تولید گوشت و شیر می شوند. در حشرات نیز وجود پروبیوتیک ها در روده گوارشی آن ها و تاثیر در افزایش باروری آن ها به اثبات رسیده است. در تحقیق حاضر هدف بررسی تاثیر عصاره رازیانه در افزایش عملکرد پروبیوتیک ها در روده گوارشی مگس سرکه می باشد. پروبیوتیک ها در حشرات کاربرد فراوانی دارد. به عنوان مثال در زنبورعسل پروبیوتیک ها باعث تنظیم pH عسل و خاصیت ضد باکتری به دلیل پائین آمدن pH عسل در اثر وجود باکتری های لاکتوباسیل دارد. طی تحقیقی که توسط تاج آبادی و همکاران در سال 2011 نتایج حاصل از مطالعه آن ها نشان داد لاکتوباسیلوس های جدید در دستگاه گوارش زنبور های عسل در استان مرکزی با فلوتایپ جدید و نزدیک به لاکتوباسیلوس فارسیمینس در گروهی از جنس لاکتوباسیل ها قرار گرفت که این تفاوت با بررسی 16srDNA مورد مطالعه قرار گرفت و تاثیر آن در بالابردن کیفیت عسل و کاهش مرگ و میر زنبور عسل تاثیرگذار بوده است(36). در ایران تحقیقات تاکنون درخصوص تاثیر پروبیوتیک ها در مگس سرکه انجام نشده است و تحقیق حاضر می تواند اطلاعات مفیدی برای محققین کشورمان به دنبال داشته باشد. بنابراین در تحقیق حاضر با هدف نقش رازیانه و وجود پروبیوتیک ها در افزایش باروری مگس ها مورد مطالعه قرار گرفته است. در این ارتباط مگس ها تحت تیمارهای مختلف رازیانه در محیط کشت قرار گرفته و با گروه کنترل مورد مقایسه قرار گرفتند. با توجه به این که معیار افزایش باروری در مگس های ماده تاخیر در جفت گیری، طول مدت جفت گیری، افزایش تخم ریزی و تعداد مگس های به دنیا آمده بودند مورد بررسی قرار گرفتند. تمامی پارامترهای مورد بررسی زمانی که از غلظت های مختلف رازیانه استفاده شد، بیشتر از گروه کنترل بودند. در خصوص تاخیر در جفت گیری یعنی مدت زمان لازم جهت نزدیکی مگس نر به ماده که هر چه قدر زمان کمتر باشد به طبع قدرت جنسی مگس نر نیز بالاتر می باشد و همین طور در مورد ماده نیز تمایل نزدیک شدن به مگس نر نیز بیشتر و زمان کمتری طول می­کشد که در مورد تحقیق حاضر با توجه به غلظت بالای عصاره رازیانه میران تمایل مگس ماده نیز بیشتر بوده است(غلظت 75 میکروگرم). در مورد طول مدت جفتگیری نیز معمولاً هرچه قدر طول جفتگیری در مگس نر بیشتر و همین طور مدت زمان تمایل جفتگیری در مگس ماده بیشتر باشد به معنی آن است که قدرت باروری مگس ها بالاتر است که این پارامتر در مورد غلظت بالا(75 میکروگرم) نسبت به گروه کنترل بیشتر بوده است. به طور کلی کاهش زمان تاخیر در جفت­گیری و طول مدت زمان جفت گیری از جمله پارامترهای مهم در بحث باروری مگس سرکه می باشد(39). درخصوص میزان تخم ریزی نیز هر چه قدر تعداد تخم ها بیشتر باشد به طبع میزان باروری مگس ماده هم بالا بوده و در مورد مگس نر نیز همین وضعیت صدق می کند زیرا در مگس های نر افزایش تولید اسپرم که در کیسه ذخیره اسپرم در مگس ماده(Spermatechae) ذخیره می گردد و در افزایش تخم ریزی موثر است و در تحقیق حاضر غلظت بالا عصاره رازیانه(75 میکروگرم) بیشترین تعداد تخم ها را در شمارش تخم بر روی محیط کشت داشته است. در مورد تعداد تخم های بازشده نیز غلظت بالا عصاره رازیانه نیز موثر بوده است. زیرا هر چه قدر باروی مگس­های نر بالاتر باشد و جنین های سالم تری در تخم باشد به طبع تخم های بیشتری باز شده و لاروها به دنیا می آیند(6). محققین مختلفی ارتباط بین تغییرات در سلول های غدد جنسی و مصرف غلظت های مختلف عصاره های گیاهی را مورد بررسی قرار دادند. در این ارتباط از عصاره چای سبز به دلیل داشتن پلی فنل باعث کاهش سایز سلول های غدد جنسی، کاهش تعداد سلول های غدد جنسی و هم چنین کاهش سایز غدد جنسی مگس نر شدند. علاوه بر آن سایز مگس های ماده نیز در مقایسه با گروه کنترل کوچک تر بودند. تعداد تخم های گذاشته شده، تعداد لاروهای تبدیل شده به مگس و تعداد مگس ها هم کمتر از گروه کنترل بودند(7). در تحقیق حاضر از عصاره رازیانه استفاده شده است. گزارشات متعددی مبنی بر تاثیر عصاره رازیانه در افزایش باروری در حیوانات مختلف وجود دارد. رازیانه در طب سنتی به عنوان یک ادویه استفاده می شود. فعالیت های دیورتیک، ضد درد و ضد تب، هم چنین در فعالیت های آنتی اکسیدانی و میوه رنگ­رزی یافت شده است(12). از مهم ترین ترکیبات موجود در رازیانه فیتواستروژن که یک ماده بیولوژیکی فعال است و می تواند به مانند استروژن عمل کند. هم چنین میزان شیردهی در زنان را افزایش می دهد و علائم یائسگی را در زنان به تاخیر می اندازد(25). علاوه بر آن نتایج تحقیق محققین نیز نشان داده است که عصاره رازیانه در کاهش عوارض سندرم پلی کیستیک و همچنین دیابت نوع دو دخالت دارد(34، 30، 28، 11). اکثر بیماران دیابتی دارای اختلالات کلیوی هستند(11). مصرف استرادیول والرات باعث افزایش بیشتر در میزان چربی می شود که به آسیب های پیشرفته کلیه منجر می شود(35). علاوه بر آن امروزه بسیاری از داروها برای درمان PCOS مورد استفاده قرار می­گیرنداستفاده از داروهای گیاهی خصوصاً گیاه رازیانه می تواند موثر باشد. همان طور که قبلاً بدان اشاره شد استفاده از پروبیوتیک ها نیز نقش به سزایی در طبیعت دارد. وجود پروبیوتیک ها در روده مگس سرکه می تواند کمک به سزائی در افزایش باروری این مگس ها داشته باشد. در یک مطالعه، اثرات مستقیم و متقابل نسل جدید باکتری های روده بر روی جفت­گیری و رفتار باروری D. melanogaster را نشان داده است. نتایج نشان می دهد که اثر مثبت LP بر موفقیت تولید مثل در مگس های نر در مقایسه با گروه کنترل بر وزن، تاثیر معنی داری نشان داد. این مطالعه برای اولین بار نشان داد که ترکیب باکتری های روده به موفقیت تولید مثل در D. melanogaster کمک می­نماید. نتایج محققین با توجه به اثرات گسترده ای از میکروب بیوتین روده در طیفی از گونه های باکتری ها مشخص شده است(38، 32، 31، 15). و پیامدهای بالقوه باکتری های روده را در فرآیندهای تکاملی کلیدی مانند انتخاب جنسیت نشان می دهد. در تحقیق حاضر به منظور بررسی جمعیت پروبیوتیک ها در محیط کشت مگس سرکه که در اثر مصرف عصاره رازیانه تحت تاثیر قرار گرفته بودند، از تکنیک Real Time PCR استفاده گردید، نتایج تحقیق نشان داد زمانی که از عصاره حاوی رازیانه به جیره غذایی مگس ها اضافه شد اثر معنی داری در رشد پروبیوتیک ها در مقایسه با گروه کنترل مشاهده گردید. در تحقیق حاضر هر چند که نتایج PCR موید وجود باکتری لاکتوباسیلوس میباشد ولی فراوانی باکتری لاکتوباسیلوس در مقایسه با گروه کنترل با کمک RT-PCR مشخص می­گردد(27). تغذیه مستقیم باکتری های پروبیوتیک شامل تولید ویتامین، دسترسی به مواد معدنی و عناصر کمیاب و تولید آنزیم های مهم گوارشی می باشد. استفاده از پروبیوتیک ها برای افزایش پارامترهای زیستی رشد و بهبود توانایی مقاومت در برابر بیماری ها در انسان به خوبی شناخته شده است(20، 17). علاوه بر مباحثی که درخصوص پروبیوتیک ها شرح داده شد، تکنیک های شناسایی این باکتری ها و بررسی کمیت آن ها، تکنیک qRTPCR تکنیک بسیار حساس و دقیقی است. روش PCR روشی بسیار وقت گیر، پر هزینه و نسبتاً غیر حساس می باشند. لی و همکاران در سال 2010 روش­های هیبریداسیونDNA وسطح آستانه DNA را جهت اندازه گیری کمی DNA مقایسه کردند که Real Time PCR برای روش ژنومی باکتری E.coli حساسیت و دقت روش 30 برابر بالاتر از روش معمولی PCR دارد. در یک مطالعه از روش سریع، بسیار حساس و اختصاصی RT-PCR بر مبنای استفاده از رنگ سایبر گرین تشخیص آلودگی DNA ناشی از باکتری E.Coliبه عنوان میزبان در اینتروفرون نوترکیب استفاده شد. این روش قادر است با حساسیتی مناسب، در زمانی اندک و براساس منحنی استاندارد را در محصولات داروئی نشان دهد. علاوه بر آن از ژن 16srDNA به عنوان یک ژن مارکر در شناسایی باکتری E.Coliاستفاده شده است. به طور کلی روش RT-PCR علاوه بر داشتن حساسیت و ویژگی بالا دارای کاربردی آسان، سرعت زیاد و قیمت تمام شده مناسبی نیز می باشد(29). که در تحقیق حاضر از این روش جهت شناسایی کمیت پروبیوتیک ها استفاده شد.

نتیجه گیری کلی:

در تحقیق حاضر تاثیر عصاره گیاه رازیانه بر باروری مگس سرکه و نقش پروبیوتیک ها در آن مورد بررسی قرار گرفته است. در این ارتباط عصاره رازیانه به غلظت­های مختلف تقسیم بندی شدند. غلظت ها شامل 25، 50 و 75 میکرو گرم بر میلی لیتر به محیط کشت اضافه شد علاوه بر آن از نمونه کنترل جهت تایید نتایج استفاده شد(محیط کشت فاقد عصاره رازیانه). مگس­های سرکه طی دوماه مورد مطالعه قرار گرفتند و نتایج موید تاثیر عصاره رازیانه در افزایش باروری آن­ها داشتند. گزارشات متعددی مبنی بر تاثیر پروبیوتیک ها در افزایش باروری نیز وجود دارد. پروبیوتیک ها با فعالیت داخل روده گوارشی باعث تولید ویتامین ها و پروتئین های متعدد می شوند که جهت باروری در مگس ها و به طور کلی در ارگانیسم های مختلف نیازمند می باشد. با توجه به بررسی درمحیط کشت مگس سرکه، دو سویه از باکتری لاکتوباسیلوس پلانتاروم و استوباکتر پوموروم تلقیح کردند. نتایج تحقیق نشان داد که میزان تخم ریزی ، طول دوره جفت­گیری افزایش رفتارهای جنسی(Sexual behavior) و افزایش تعداد نتاج منجر گردید. در نتایج چندین پارامتر در نظر گرفته شد، این پارامترها شامل تاخیر در جفت گیری،طول مدت جفت گیری، تعداد تخم ریزی و تعداد مگس های به دنیا آمده مورد بررسی قرار داده شد. نتایج تحقیق نشان داد زمانی که از غلظت بیشتر عصاره رازیانه( 75میکرو گرم بر میلی لیتر) در محیط کشت استفاده شد، میزان باروری در مگس سرکه ماده بیشتر از غلظت کمتر و هم چنین گروه کنترل بودند. علاوه بر آن با انجام واکنش PCR و qRT-PCR وجود باکتری لاکتوباسیلوس تایید گردید. این باکتری به عنوان یک باکتری پروبیوتیک و مفید در روده مگس وجود دارد که حین تغذیه مگس از محیط کشت وارد محیط کشت شده و در حین تغییرات سیکل مگس(تبدیل تخم به لارو، شفیره و نهایتاً مگس بالغ، تبادل باکتریائی انجام می شود). با توجه به تحقیق حاضر پیشنهاد می شود از عصاره سایر گیاهان که در بیماری­های مختلف نظیر دیابت نوع دو، سندرم پلی کیستیک تخمدان و بسیاری از سرطان ها به کار می­روند با آزمایش بر روی مگس سرکه وضعیت تاثیر این عصاره ها در مگس سرکه و مقایسه آن با گروه کنترل مورد بررسی و نتیجه گیری قرار گیرد. علاوه بر آن می­توان با استخراج عصاره محیط کشت در طی مسیر داروسازی، داروئی با اثربخشی بالاتر سنتز و به بازار عرضه نمود

منابع
1-طاهریان،ع.، دهقانیان، م. 1386. بررسی اثر عصاره آبی میوه گیاه رازیانه(Foeniculum vulgare ) بر تعدیل درد نوروژنیک و درد التهابی در موش سوری درمدل ارزیابی درد فرمالین، مجله علمی دانشگاه علوم پزشکی کردستان، دوره دوازدهم،شماره 2، صفحه 35 -28.
2- نیتی، م. 1394. بررسی اثر ضد تریکومونایی عصاره های گیاهان ریواس و رازیانه بر روی تریکوموناس واژینالیس در شرایط آزمایشگاهی. مجلّه طب سنّتی اسلام و ایران، سال ششم، شماره سوم، 13-15.
3.Agrawal, N., Pallos, J., Slepko, N., Apostol, BL., Bodai, L. (2005). Identification of combinatorial drug regimens for treatment of Huntington's disease using Drosophila. Proc Natl Acad Sci USA; 102; 3777-3781.
4.Apun‐Molina, JP., Miranda, AS., Gonzalez, AL., Martinez‐Diaz, S.F., Rojas‐Contreras, M. (2009). Effect of potential probiotic bacteria on growth and survival of tilapia Oreochromis niloticus L., cultured in the laboratory under high density and sub‐optimum temperature. Aquaculture Research, 4; 887– 894
5.Apidianakis, Y., Rahme, LG. (2011). Drosophila melanogaster as a model for human intestinal infection and pathology. Dis Model Mech, 4; 21-30.
6.Aymerich, T., Holo H., Håvarstein LS., Hugas, M., Garriga, M., Nes, IF. (1996). Biochemical and genetic characterization of enterocin A form Enterococcus faecium, a new antilisterial bacteriocin in the pediocin family of bacteriocins. Appl Environ Microb, 62; 1676-1682.
7.Apidianakis, Y., Que, YA., Xu, W., Tegos, GP., Zimniak, P., Hamblin, MR. (2012). Down-regulation of glutatione S-transferase α 4 (hGSTA4) in the muscle of thermally injured patients is indicative of susceptibility to bacterial infection. FASEB J, 26(2); 730–737.
8.Buchon, N., Broderick, NA., Chakrabarti, S., Lemaitre, B. (2009a). Invasive and indigenous microbiota impact intestinal stem cell activity through multiple pathways in Drosophila. Genes Dev, 23; 2333–2344.
9.Bangham, J., Chapman, T., Partridge, L. (2002). Effects of body size, accessory gland and testis size on pre- and postcopulatory success in Drosophila melanogaster. Anim. Behav, 64; 915–921.
10.Baird, DT., Collins, J., Egozcue, J., Evers, LH., Gianaroli, L., Leridon, H. (2005). Fertility and ageing. Hum Reprod Update, 11; 261-76.
11.Castro, AF., Coresh, J. (2009). CKD surveillance using laboratory data from the populationbased National Health and Nutrition Examination Survey (NHANES). Am. J. Kidney, 53; S46-55.
12.Choi, EM., Hwang, JK. (2004). Antiinflammatory analgesic and antioxidant activities of the fruit of Foeniculum vulgare. Fitoterapia, 75; 557-565.
13.Chapman, TLF., Liddle, JM., Kalb, MF., Partridge, L. (1995). Cost of mating in Drosophila melanogaster females is mediated by male accessory gland products. Nature, 373; 241-244.
14.Chapman, T., Davies, SJ. (2004). Functions and analysis of the seminal fluid proteins of male Drosophila melanogaster fruit flies. Peptides, 25; 1477-1490.
15.Corby Harris, V., Pontaroli, AC., Shimkets, LJ., Bennetzen, JL., Habel, KE. (2007) Geographical distribution and diversity of bacteria associated with natural populations of
Drosophila melanogaster. Applied and Environmental Microbiology,73; 3470-3479.
16.Coulthart, MB., Singh, RS. (1988). Low genie variation in male-reproductive tract proteins of Drosophila melanogaster and D. simulans. Mol Biol Evol., 5; 167-181.
 
17.Franklin, A., Acar, J., Anthony, F., Gupta, R., Nicholls, T., Tamura, Y. (2001). Antimicrobial resistance: harmonisation of national antimicrobial resistance monitoring and surveillance programmes in animals and in animal derived food. Scientific and Technical Review of the Office International des Epizooties (Paris), 20; 859–870.
18.Fujiki, H., Sueoka, E., Watanabe, T., Suganuma, M. (2015). Primary cancer prevention by green tea, and tertiary cancer prevention by the combination of green tea catechins and anticancer compounds. Journal of Cancer Prevention, 20(1); 1–4.
19.Forester, S. C., Lambert, J. D. (2011). The role of antioxidant versus pro-oxidant effects of green tea polyphenols in cancer prevention. Molecular Nutrition and Food Research, 55(6); 844- 854.
20.Gildberg, A., Mikkelsen, H. (1998). Effect of supplementing the feed of Atlantic cod (Gadus morhua) fry with lactic acid bacteria and immunostimulating peptides during a challenge trial with Vibrio anguillarum. Aquaculture, 167; 103–113.
21.Gatesoupe, F.J. (1994). Lactic acid bacteria increase the resistance of turbot larvae, Scophthalmus maximus, against pathogenic Vibrio. Aquat. Living Resour, 7; 277–282.
22.Hedges, LM., JC., Brownlie SL.,’Neill, O., Johnson, KN. (2008). Wolbachia and Virus Protection in Insects. Science, 322; 702.
23.Healy, DL., Trounson, AO., Andersen, AN. (1994). Female infertility: causes and treatment. Lancet, 343; 1539-44.
24.Ingman-Baker, J. Candido, E.P.M. (1980). Proteins of the Drosophila melanogaster male reproductive system: Two dimensional gel patterns of proteins synthesized in the XO, XY, and XYY testis and paragonial gland and evidence that the Y chromosome does not code for structural sperm proteins. Biochem. Genet, 18; 809-828.
25.Khani, B., Mehrabian, F., Khalesi, E., Eshraghi, A. (2011). Effect of soy phytoestrogen on metabolic and hormonal disturbance of women with PCOS. J Res Med Sci, 16; 297- 230.
26.Khazaei, M., Montaseri, A., Khazaei, MR., Khanahmadi, M. (2011). Study of Foeniculum vulgare effect on folliculogenesis in female mice. Int J Fertil Steril., 5; 122-7.
27.Kumazaki, T., Hamada, K., Mitsui, Y. (1994). Detection of mRNA expression in a single cell by direct RT-PCR. Biotechniques, 16; 1017–1019.
28.Lau, DC., Yan, H., Dhillon, B. (2006). Metabolic syndrome: a marker of patients at high cardiovascular risk. Can J Cardiol., 22; 85B-90B.
29.Lee, DH., Jeong, HS., Kim, TE., Oh, Sh., Kim, IS. (2008). Real-Time RT-PCR for validation of reovirus type 3 safety during the manufacture of mammalian cell culture-derived biopharmaceuticals. Korean. J. Microbiol., 44(2); 56-65
30.Mirzayi, F., Kazemi, N. (2008). Prevalence of polycystic ovary syndrome in women with type 2 diabetes in Kerman, Iran. Metab Syndr Relat Disord, 6; 215-217.
31.Ostad, SN., Soodi, M., Shariffzadeh, M., Khorshidi, N., Marzban, H. (2001).The effect of fennel essential oil on uterine contraction as a model for dysmenorrhea, pharmacology and toxicology study. J Ethnopharmacology,76; 299-304.
32.Panayidou, S., Ioannidou, E., Apidianakis, Y. (2014). Human pathogenic bacteria, fungi, and viruses in Drosophilae: Disease modeling, lessons, and shortcomings. Virulence, 5; 253-269.
33.Senatore, F., Oliviero, F., Scandolera, E., Taglialatela-Scafati, O., Roscigno, G., Zaccardelli, M. (2013) Chemical composition, antimicrobial and antioxidant activities of anethole-rich oil from leaves of selected varieties of fennel [Foeniculum vulgare Mill. ssp. vulgare var. azoricum (Mill.) Thell]. Fitoterapia, 90; 214-9. 
34.Schmidt, T., Stumm-Zollinger, E., Chen, P.S. (1985). Protein metabolism of Drosophila melanogaster male accessory glands-III. Stimulation of protein synthesis following copulation. Insect Biochemistry,15;391–401.
35.Stevenson, FT., Wheeldon, CM., Gades, MD., Kaysen, GA., Stern, JS., van Goor, H. (2000). Estrogen worsens incipient hypertriglyceridemic glomerular injury in the obese. Zucker rat. Kidney Int, 57; 1927- 1935.
36.Tajabadi, N., Mardan, M., Manap, M. Y. A., Shuhaimi, M., Meimandipour, A., Natheghi, L. (2011). Detection and identification of Lactobacillus bacteria found in the honey stomach of the giant honeybee Apis dorsata. Apidologie, 42; 642.946
37.Whalen, M., Wilson, G.T. (1986). Variation and genomic localization of genes encoding Drosophila melanogaster accessory gland proteins separated by SDSPAGE. Genetics, 114; 77-92.
38.Wolfner, MF. (1997). Tokens of love: functions and regulation of Drosophila male accessory gland products. Insect Biochem Mol Biol., 27;179–192.
39.Wolfner, M. F. (2002). The gifts that keep on giving: physiological functions and evolutionary dynamics of male seminal proteins in Drosophila. Heredity, 88; 85–93.