مقایسه اثر اگزوزوم های مشتق از سلول های سرتولی با ویتامین C بر آسیب های ناشی از میدان الکترومغناطیس در سلول های بنیادی اسپرماتوگونی

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی،دانشکده علوم،واحدمشهد دانشگاه آزاداسلامی ،مشهد،ایران.

2 گروه زیست شناسی و مرکز تحقیقات بیولوژی کاربردی تکوین جانوری، واحد مشهددانشگاه آزاد اسلامی ، مشهد.ایران

3 دانشگاه خوارزمی، دانشکده علوم زیستی، گروه سلولی مولکولی، تهران، ایران

چکیده

زمینه و هدف: سلول های بنیادی اسپرماتوگونی( SSCs) به عنوان سلول های بنیادی بالغ برای اسپرماتوژنز ضروری هستند. میدان­های الکترومغناطیسی(EMF) باعث اختلال در فعالیت زیستی این سلول ها و اسپرماتوژنز می شود. آنتی اکسیدان ها هم­چون ویتامین C آسیب های ناشی از EMF را از طریق کاهش استرس اکسیداتیو بهبود می بخشند. هم­چنین سیگنالینگ پاراکرین سلول های سرتولی در حفظ و تمایز SSCها نقشی اساسی دارد. در نتیجه به مقایسه اثر ویتامین C و اگزوزوم های مشتق از سلول های سرتولی بر آسیب های ناشی از EMF در SSCها پرداخته شد.
روش کار: سلول های اسپرماتوگونی و سرتولی از بیضه موش های نر نابالغ جداسازی شد. فعالیت آلکالین فسفاتازی SSCها بررسی شد. SSCها در معرض میدان الکترومغناطیس 50 هرتز و شدت 5/2 میلی تسلا به مدت یک ساعت، پنج روز قرار گرفتند و توسط غلظت بهینه ویتامین C و غلظت های مختلف اگزوزوم تیمار شدند. سپس زیستایی، توانایی کلونی زایی و آپوپتوز این سلول ها بررسی گردید.
یافته ها:EMF باعث کاهش زیستایی، کلونی زایی و تغییرات هسته SSCها شد. هم چنین نتایج به دست آمده با افزایش بیان ژن کاسپاز 9 و کاهش ژن SOD تأیید گردید. افزودن ویتامین C و اگزوزوم ها باعث بهبود تغییرات القائ شده توسط EMF در SSCها شد، با این وجود اگزوزوم ها دارای اثرات بهبود بخش بیشتری نسبت به ویتامین C بود
 نتیجه گیری: یافته ها اثربخشی اگزوزوم ها را به عنوان یک عامل درمانی جدید نشان داد که می تواند آسیب های ریز محیط SSCها را پس از قرار گرفتن در معرض EMF بازیابی کند.

کلیدواژه‌ها


عنوان مقاله [English]

Comparison of the effect of exosomes derived from Sertoli cells with vitamin C on damage induced by electromagnetic field (50 Hz) in spermatogonial stem cells

نویسندگان [English]

  • Farzaneh Salek 1
  • Javad Baharara 2
  • Khadijeh Nejad Shahrokhabadi 1
  • Elaheh Amini 3
1 Department of Biology, Faculty of Sciences, Mashhad Branch, Islamic Azad University, Mashhad, Iran
2 Department of Biology & Research Center for Animal Development Applied Biology, Faculty of Sciences, Mashhad Branch, Islamic Azad University, Mashhad, Iran.
3 Department of Cellular & Molecular Biology, Faculty of Biological Sciences, Kharazmi University, Tehran, Iran
چکیده [English]

Introduction & Objective: Spermatogonial stem cells (SSCs) as adult stem cells are crucial for spermatogenesis. Electromagnetic fields (EMF) leads to biological activity disruption of these cells and spermatogenesis. Antioxidants like vitamin C can reduce the damage caused by EMF through oxidative stress reduction. Recent studies also reported the key role of Sertoli cell paracrine signaling in regulating the maintenance and differentiation of SSCs. Thus, we examined and compared the effect of vitamin C and exosomes derived from Sertoli cells on damage induced by EMF in SSCs. Material and Methods: SSCs and Sertoli cells were isolated from the testes of immature male mice. The alkaline phosphatase activity of SSCs was investigated. SSCs were exposed to 50 Hz EMF intensity of 2.5 mT for one hour/five days and were treated with the optimal concentration of vitamin C and various concentrations of exosome. Then the rate of viability, colonization capacity, and apoptosis of these cells were examined. Results: Our results showed the destructive effect of EMF by reducing viability, colonization rate and alteration of SSCs nuclei. Also, these results were confirmed by increasing expression level of Caspase 9 as apoptotic gene and down-regulation of SOD as antioxidant gene. The addition of vitamin C and exosomes improved the alterations induced by EMF in SSCs; however exosomes had more ameliorative effect in comparison with vitamin C on these alterations. Conclusion: These findings demonstrated the capacity and effectiveness of exosomes as a new therapeutic agent that can restore SSCs microenvironment damaged caused by EMF exposure.

کلیدواژه‌ها [English]

  • Spermatogonial Stem Cells
  • Sertoli cells
  • Exosomes
  • Electromagnetic field
  • Apoptosis

مقدمه

 

در سال های اخیر پیشرفت تکنولوژی و استفاده روز افزون از تجهیزات الکتریکی و الکترونیکی زندگی بشر را ساده تر کرده است، اما یکی از عوارض جانبی استفاده از این دستگاه ها تولید میدان های الکترومغناطیسی (EMF) است که قرار گرفتن در معرض آن ها اجتناب ناپذیر است و می تواند تهدیدی برای زندگی بشر محسوب شود(9). طی دهه های گذشته، مطالعات نشان داده اند که قرار گرفتن طولانی مدت در معرض EMF ممکن است اثرات مخربی بر سیستم تولید مثل داشته باشد(14). بیضه نسبت به عوامل محیطی مختلفی هم­چون هایپرترمی، التهاب، تشعشعات و داروهای شیمیایی بسیار حساس است و این عوامل می تواند منجر به آپوپتوز سلول های جنسی و ناباروری شود(4). نتایج تحقیقات مختلف در مورد اثرات بیولوژیک EMF بسیارمتناقض بوده و تفاوت ها عمدتاً مربوط به مکانیسم های مولکولی احتمالی پاسخ سلولی به EMF است، که هنوز هم کاملاً درک نشده است(20). یکی از اولین پاسخ های سلولی به فرکانس های مختلف EMF تولید گونه های فعال اکسیژن(ROS) و سایر رادیکال های آزاد است. مطالعات نشان داده که افزایش تولید ROS مستقیماً در آسیب اکسیداتیو اجزای سلولی مانند لیپیدها، پروتئین ها و اسیدهای نوکلئیک نقش دارد(15). علاوه بر این، به خوبی مشخص شده است که تولید بیش از حد ROS باعث ایجاد تغییرات در چرخه سلولی، تغییر بیان ژن ها و مکانیسم های آنتی اکسیدانی آنزیمی و غیر آنزیمی می­شود(10). عوامل محیطی هم چون میدان های الکترومغناطیس می توانند از طریق استرس اکسیداتیو و اختلال در سیستم های دفاعی آنتی اکسیدانی اثرات منفی در فرآیند اسپرماتوژنز و در نتیجه باروری مردان داشته باشند(35). اسپرماتوژنز یک فرآیند پیچیده تکوینی است که به موجب آن اسپرم های بسیار تخصصی هاپلوئید از تکثیر و تمایز سلول های بنیادی اسپرماتوگونی(SSCs)، میوز اسپرماتوسیت ها و اسپرمیوژنز تولید می شوند(13). SSC ها به عنوان سلول های بنیادی بالغ با ویژگی خودنوزایی در بیضه، مسئول اسپرماتوژنز مداوم در طول زندگی مردان هستند و فعالیت های بیولوژیکی این سلول­ها می تواند تحت تأثیر مواد شیمیایی و یا تشعشات قرار گیرد(24). تعادل دقیق بین خودنوزایی و تمایز SSCها اهمیت زیادی در حفظ باروری مردان دارد. فعالیت SSC ها در طول اسپرماتوژنز توسط ریزمحیط یا نیچ بیضه تنظیم می شود که از SSC ها و سلول های سوماتیک به خصوص سلول های سرتولی تشکیل شده است(25). سلول های سرتولی به دلیل تولید فاکتورهای مغذی، تمایزی و تعدیل کننده سیستم ایمنی نقش مهمی در ایجاد ریزمحیطی مناسب ایفا می کنند. سلول های سرتولی عوامل مختلف رشد و سایتوکاین ها هم چون فاکتور نوروتروفیک مشتق از سلول های گلیال(GDNF)، فاکتور سلول های بنیادی(SCF)، پروتئین مورفوژنیک استخوان 4(BMP4)، فاکتور رشد فیبروبلاست2(FGF2)، فاکتور رشد اپیتلیال(EGF)، و غیره ترشح می کنند(36). در حقیقت سلول های سرتولی از طریق تعاملات مستقیم سلولی، ترشح آندوکرین و پاراکرین خود مسیرهای سیگنالینگ و ارتباطی زیادی را میانجی­گری می کنند که در نهایت سرنوشت SSC ها و اسپرماتوژنز را تحت تأثیر قرار می دهد(26). هم چنین مکانیسم جدید انتقال بین سلولی در دو دهه گذشته کشف شده که به صورت وزیکول های خارج سلول(EV) است و در کنترل این ارتباطات درون سلولی نقش دارد(23). در طی چند سال گذشته، مشخص شده است که این وزیکول های خارج سلول را می توان از انواع مختلف سلول ها و مایعات بیولوژیکی استخراج کرد و این وزیکول ها حاوی عوامل های مختلفی از جمله فاکتورهای رشد، سایتوکاین ها، mRNA ها، microRNA ها و لیپیدهای فعال زیستی است که می­تواند بر بسیاری از فرآیندهای فیزیولوژیکی و پاتوفیزیولوژی تأثیر بگذارد(18). وزیکول های خارج سلول را می توان براساس سایز آن ها در 3 گروه طبقه بندی کرد: اگزوزوم ها( nm 150 -30) ، میکرووزیکول­ها(nm 1000 -100) و اجسام آپوپتوتیک (nm 1000<)(16). به ویژه، اگزوزوم ها حاوی محموله­های خاصی از ترکیبات براساس نوع سلول منشاء خود هستند. اگزوزوم ها پیام رسان های حیاتی هستند و در فرآیندهای فیزیولوژیکی و پاتولوژی مختلفی نقش دارند و می توان برای کاربردهای درمانی متعددی از آن­ها استفاده کرد(37). هم چنین مطالعات متعددی نشان داده­اند که خاصیت آنتی اکسیدانی ترکیبات گیاهی با دفاع استرس اکسیداتیو در ارتباط است و می تواند اثرات منفیEMF را کاهش دهد(30). سیستم های دفاعی آنتی اکسیدانی بسیار مهم هستند زیرا محافظت طبیعی را برای همه بافت های بدن در برابر اثرات مضر رادیکال های آزاد فراهم می کنند. ویتامین C(L- آسکوربیک اسید)(Vit C) به عنوان یک آنتی اکسیدان مهم در نظر گرفته می شود و در بسیاری از فرآیندهای متابولیکی و التهاب نقش مؤثری را ایفا می کند و از سلول ها در برابر صدمات اکسیداتیو مختلف محافظت می کند(29). ویتامین C در شرایط آزمایشگاهی برای اطمینان از تولید مناسب ROS، مهار سیگنال های آپوپتوز و فعال کردن سیگنال های ضد آپوپتوزی به محیط های کشت اضافه می شود(34). مطالعات مختلف نقش ویتامین C از طریق دفع مستقیم ROS و بهبود فعالیت آنزیم های آنتی­اکسیدانی در جلوگیری از آسیب های سلولی ناشی از تشعشعات در فرآیند اسپرماتوژنز موش را گزارش کرده اند(8). با توجه به نقش سلول های سرتولی و اگزوزوم­ها به عنوان یک عامل واسطه گر پاراکرین، هدف از این مطالعه بررسی و مقایسه اثر بهبودبخش اگزوزوم های مشتق شده از سلول های سرتولی با آنتی اکسیدانی هم­چون ویتامین C بر آسیب های ناشی از میدان الکترومغناطیس50 هرتز EMF در سلول های SSC است.

مواد و روش ها

حیوانات

موش های نابالغ نر نژادNMRI (6-3 روزه) در حیوانخانه مرکز تحقیقات بیولوژی کاربردی تکوین جانوری در شرایط استاندارد 12 ساعت چرخه روشنایی-تاریک، دمای C °  22  ± 2 و دسترسی آزاد به آب و غذا نگهداری شدند. کلیه روش های مورد استفاده در این پژوهش بر طبق مصوبات کمیته اخلاق در پژوهش­های زیست پزشکی دانشگاه آزاد اسلامی واحد مشهد انجام شد(IR.IAU.MSHD.REC.1398.088).

جداسازی و کشت سلول های اسپرماتوگونی

جداسازی سلول های اسپرماتوگونی با استفاده از روش هضم آنزیمی دو مرحله ای با تغییرات جزئی صورت گرفت. به طور خلاصه، بافت بیضه موش های نر نابالغ جدا شده و به محیط هضم آنزیمی حاوی کلاژنازIV،DNase و هیالورونیداز اضافه و به صورت مکانیکی به قطعات کوچک برش داده شد. سپس نمونه­ها به مدت 15 دقیقه در داخل انکوباتور C ° 37 و 5 درصد CO2 قرار داده شد و تریپسین به نمونه ها اضافه شد. پس از گذشت زمان مناسب،  سوسپانسیون سلولی با سرعت 1200 دور در دقیقه سانتریفوژ شد. در مرحله دوم هضم آنزیمی، پلت سلولی مجدد در محیط هضم تازه انکوبه و سانتریفیوژ شدند.سپس سوسپانسیون سلول های اسپرماتوگونی و سرتولی به صورت هم کشتی در محیط کشت DMEM-F12 حاوی 10 درصد FBS کشت داده شدند(26).

جداسازی و خالص سازی اگزوزوم

در این مطالعه از اگزوزوم های مشتق از سلول های سرتولی که در مطالعه قبلی توسط سالک و همکاران جداسازی و شناسایی گردیده بود، استفاده شد(28). بدین صورت که به منظور جداسازی اگزوزوم، ابتدا سلول های سرتولی با استفاده از پروتکل Scarpino استخراج شدند. به طور خلاصه، سوسپانسیون سلولی حاصل از هضم آنزیمی به فلاسک های پوشیده از لکتین اضافه شد. پس از انکوباسیون، سلول های سرتولی به کف فلاسک چسبیده و سلول های شناور از محیط حذف شدند. در نهایت سلول های سرتولی در محیط کشت DMEM-F12 جهت استخراج اگزوزوم کشت داده شدند. محیط کشت سلول های سرتولی، زمانی که سلول ها تراکم در حدود 70 الی 80 درصد از فلاسک را کسب کردند، حذف شد. سپس به مدت 24 الی 48 ساعت در محیط کشت فاقد سرم کشت داده شدند. سپس محلول روی محیط کشت جمع آوری و اگزوزوم­ها با سانتریفیوژ با سرعت های مختلف(g 100000) خالص سازی گردید و در نهایت رسوب اگزوزومی در PBS حل شد.

ارزیابی فعالیت آلکالین فسفاتاز

فعالیت آلکالین فسفاتاز برای شناسایی سلول های بنیادی اسپرماتوگونیال انجام شد. کلونی های SSC به مدت 15 دقیقه در فرمالدئید 4٪ (4 درجه سانتی گراد) قرار داده شدند و سپس دو بار با محلول تریس شسته شدند (9/8 = pH) و به سلول ها سوبسترای نفتل فسفات 01/0 ونمک ویوله 06/0درصد اضافه شد و به مدت 20 دقیقه در 37 درجه سانتی گراد انکوبه شدند. سرانجام، سلول ها دو بار با آب مقطر شسته و در زیر میکروسکوپ معکوس مشاهده شدند(26).

طراحی آزمایش

به منظور تولید میدان الکترومغناطیسی با فرکانس کم(EMF) از دستگاه مولد الکترومغناطیس(طراحی و ساخته شده در مرکز تحقیقات زیست شناسی تکوینی دانشگاه آزاد اسلامی مشهد توسط دکتر بهارآرا) استفاده شد(6). سلول های اسپرماتوگونیال تحت تاثیر میدان الکترومغناطیسی با فرکانس 50 هرتز(Hz) و شدت 5/2 میلی تسلا(mT) به مدت 5 روز و در هر روز به مدت 1 ساعت قرار داده شد. سپس سلول ها در گروه های شاهد و تجربی زیر مورد بررسی قرار گرفت: 1- گروه شاهد (شرایط طبیعی کشت سلول و فاقد تیمار)، 2- گروه شاهد آزمایشگاهی دستگاه خاموش،3-گروه EMF(در معرض امواج 50 هرتز بدون تیمار)، 4- گروه شاهد آزمایشگاهی PBS(در معرض امواج 50هرتز و تیمار با PBS به عنوان حلال اگزوزوم)، 5- گروه ویتامین C(در معرض امواج 50 هرتز و تیمار با غلظت بهینه μg/ml40 ویتامین C)(34)، 6- گروه اگزوزوم(در معرض امواج 50 هرتز و تیمار با غلظت های مختلف اگزوزوم). در همه گروه ها پس پایان دوره امواج(5روز/ 1 ساعت) به مدت 48 ساعت جهت ریکاوری در شرایط طبیعی باقی مانده و سپس آنالیزهای مورد نظر صورت گرفت شد(31).

بررسی زیستایی سلول ها  با روش MTT

زیستایی سلول های بنیادی اسپرماتوگونی با استفاده از روش MTT تعیین شد. ابتدا SSC ها در معرض میدان الکترومغناطیس 50 هرتز قرار گرفتند و با غلظت های مختلف اگزوزوم(10 ، 20 و 30 میکروگرم بر میلی لیتر) و ویتامین C(40 میکروگرم بر میلی لیتر) همانطور که در طرح آزمایش شرح داده شده بود، تیمار شدند. پس از پایان دوره آزمایش زیستایی سلول ها ارزیابی شد. محلول MTT  به محیط کشت سلول ها اضافه  و به مدت 4 ساعت انکوبه شدند. سپس محیط رویی سلول ها خارج و DMSO به سلول ها اضافه شد. جذب نوری در 560 نانومتر با استفاده از اسپکتروفتومتر خوانده شد(10).

آزمون تشکیل کلونی

توانایی تشکیل کلونی SSC ها تحت تاثیر EMF و تیمارها در روز هفتم کشت با بررسی قطر و تعداد کلونی های اسپرماتوگونی توسط میکروسکوپ معکوس(المپوس ، توکیو ، ژاپن)و نرم افزار Image J  مورد بررسی قرار گرفت(3).

رنگ آمیزی هسته ای DAPI

به منظور ارزیابی مورفولوژی هسته ها از رنگ آمیزی DAPI استفاده شد. SSC ها به تعداد 106×1 در پلیت 6 خانه کشت داده شد. پس از تیمار سلول ها به مدت 5 دقیقه با متانول ثابت شدند و با رنگ DAPI به مدت 10 دقیقه رنگ آمیزی شدند. در نهایت تغییرات مورفولوژیکی توسط میکروسکوپ فلورسانس بررسی و عکس برداری شد(6).

بررسی تغییرات بیان ژن توسط Real-Time PCR

در انتهای آزمایش برای ارزیابی مولکولی در سطح بیان ژن، ابتدا استخراج RNA و سنتز cDNA بر اساس پروتکل کیت پارس توس انجام شد. جهت بررسی تأثیر EMF، تیمارهای ویتامین C و اگزوزوم استخراج شده از سلول های سرتولی بر روی سلول های SSC سطح بیان ژن آنتی اکسیدان SOD و آپوپتوزی کاسپاز-9 توسط روش Real Time -PCR مورد ارزیابی قرار گرفت(39).

 

 

جدول 1-توالی پرایمرهای مورد استفاده در آنالیز Real Time –PCR.

Reverse 5ʹ _  3ʹ

Forward 5ʹ_ 3ʹ

Gene

ACCACAGAGCAGGGATTCAAGTACC

TGGTCAGACCCGCTTATGTGTCAG

SOD

GAGAGAGGATGACCACCACAAAG

GAAGAACGACCTGACTGCCAAG

Caspase9

GGGGTGTTGAAGGTCTCAAAC

GGCACCACACCTTCTACAATG

β-actin

 

 

تحلیل آماری

آنالیز آماری توسط نرم افزار Prism، آزمون ANOVA و تست Tukey به منظورمقایسه ی داده ها صورت گرفته و  سطح 05/0> P معنی دار در نظر گرفته شد.

نتایج

فعالیت آلکالین فسفاتاز

پس از کشت سلول های بنیادی اسپرماتوگونی، سلول ها در سطح فلاسک  گسترده شدند.  با گذشت 3-4 روز از کشت، سلول های بنیادی اسپرماتوگونی به صورت کلونی مشخص شدند. این کلونی ها از نظر فعالیت آلکالین فسفاتاز مثبت بودند و به رنگ آبی مایل به بنفش از سایر سلولهای قابل تشخیص بودند. این رنگ در کلونی ها نشان دهنده فعالیت بالای آلکالین فسفاتازی توده های سلول های بنیادی اسپرماتوگونی است که از مارکرهای سلول بنیادی به شمار می رود.


 

شکل1-الف: تصویر میکروسکوپی کلونی سلول های SSC استخراج شده از بیضه موش های نابالغ(6-3 روز). ب:فعالیت آلکالین فسفاتازی مثبت کلونی ها.


زیستایی سلول ها

به منظور بررسی و مقایسه اثرات بهبودبخش ویتامین C و اگزوزوم های مشتق از سرتولی بر SSC های در معرض EMF، زیستایی این سلول ها با استفاده از روش MTT در پایان آزمایش بررسی شد. نتایج ما نشان داد در مقایسه با کنترل زیستایی SSC ها در گروه EMF به طور قابل توجهی کاهش یافته است(001/0P<) که این کاهش در غلظت بهینه ویتامین C و غلظت 10μg/ml اگزوزوم بترتیب در سطح 05/0 P< و 01/0 P< است. در حالی که در غلظت های 20 و 30 μg/ml از اگزوزوم این کاهش معنی دار نیست(نمودار1). هم چنین تجزیه و تحلیل آماری بقا SSC ها در مقایسه با گروه EMF نشان دهنده افزایش معنی دار زیستایی این سلول ها در غلظت بهینه ویتامین C و غلظت 30μg/ml اگزوزوم در سطح 05/0 >P است که این افزایش در غلظت 20 μg/ml به طور قابل ملاحظه ای در سطح 01/0 P< معنی دار است. متعاقباً، این غلظت برای تجزیه و تحلیل بیشتر در این مطالعه استفاده شد. هم چنین تفاوت معنی داری در مقایسه زیستایی گروهای شاهد(شاهد آزمایشگاهی دستگاه خاموش با گروه کنترل)(شاهد آزمایشگاهی PBS با گروه EMF) مشاهده نشد، بنابراین از این گروه­های شاهد در سایر آزمون ها صرف نظر شد.

آزمون کلونی

در این پژوهش توانایی کلونی زایی SSC ها پس از قرار گرفتن در معرض EMF در گروه های تیماری اگزوزوم و ویتامین C مورد بررسی و مقایسه قرار گرفت. نتایج این بررسی نشان داد EMF باعث کاهش معنی دار در تعداد و قطر کلونی ها می شود (001/0P<) و افزودن ویتامین C و اگزوزوم به محیط کشت باعث بهبود تعداد و قطر کلونی ها در مقایسه با گروه EMF شد که این افزایش تعداد کلونی ها در گروه اگزوزوم(20 μg/ml) افزایش قابل ملاحظه تری نسبت به گروه ویتامین C (40μg/ml) داشت(نمودار 2). در حالی افزایش قطر کلونی در هر دو گروه تیماری ویتامین و اگزوزم 01/0P< بود و تفاوت معنی داری در بین گروه تیماری ویتامین و اگزوزوم دیده نشد.

 

 

 

 

نمودار1- بررسی زیستایی سلول های SSC پس از قرار گرفتن در معرض EMF و تیمار با غلظت بهینه ویتامین C (40μg/ml) و غلظت های مختلف اگزوزوم مشتق شده از سلول های سرتولی(10 ، 20 و 30 μg/ml).

داده ها به صورت میانگین ± SD نمایش داده شده است. مقدار P (001/0,  ***P<01/0, ** P<05/0 *P<) اختلاف معناداری را در مقایسه با گروه شاهد نشان می دهد. مقدار P (001/0,  ###P<01/0, ## P<05/0 #P<) اختلاف معناداری را در مقایسه با گروه EMF نشان می دهد.

 

 

الف

ب

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 


نمودار2- بررسی و مقایسه توانایی کلون زایی SSC ها در گروه های تیماری. الف. بررسی تعداد کلونی ها. ب. بررسی قطر کلونی ها.

داده ها به صورت میانگین ± SD نمایش داده شده است. مقدار P (001/0, ***P<05/0 *P<) اختلاف معناداری را در مقایسه با گروه شاهد نشان می دهد. مقدار P (001/0,  ###P<01/0, ## P<05/0 #P<) اختلاف معناداری را در مقایسه با گروه  EMF نشان می دهد.

 

رنگ آمیزی DAPI

نتایج رنگ آمیزی DAPI نیز در شکل 2 نشان داد که هسته SSC ها در گروه EMF  قطعه قطعه شده و تغییر یافته است که نشان دهنده وقوع آپوپتوز است. پس از تیمار تعداد کمتری از  سلول ها این تغییرات در هسته خود نشان دادند که بیان گر اثر مثبت ویتامین C و بویژه اگزوزوم در محیط کشت و استرس اکسیداتیو ناشی از EMF باشد.

بیان ژن توسط Real-Time PCR

سطح بیان ژن های آنتی اکسیدانی سوپراکسید دیسموتاز(SOD) و ژن آپوپتوزی کاسپاز 9(Cas 9) در پاسخ به EMF و تیمار با ویتامین C و اگزوزوم توسط Real-Time PCR اندازه گیری شد. نتایج ما نشان داد که در سلول های اسپرماتوگونی پس از قرار گرفتن در معرض EMF سطح کاسپاز 9 افزایش یافت. هم چنین در این گروه کاهش بیان SOD نسبت به کنترل مشاهده شد. در حالی که بیان این ژن ها در گروه های ویتامین C و اگزوزوم بهبود یافت و بیان ژن آنتی اکسیدانی و کاهش کاسپاز9 افزایش یافت(نمودار 3).


 

 

 

شکل2- رنگ آمیزی DAPI نشان دهنده تغییر در هسته سلول های SSC پس از قرار گرفتن در معرض EMF و تاثیر مثبت تیمار با ویتامین C واگزوزوم های مشتق از سرتولی در تغییرات هسته.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار3- الگو بیان تغییرات ژن های سوپراکسید دیسموتاز (SOD) و کاسپاز9 (Cas9) در سلول های بنیادی اسپرماتوگونی تیمار شده با اگزوزوم های مشتق از سرتولی (μg/ml20) و غلظت بهینه ویتامین C (μg/ml40) پس از قرار گرفتن در معرض میدان الکترومغناطیس 50 هرتز.

 

 

 

بحث و نتیجه گیری

سلول های بنیادی اسپرماتوگونی به دلیل توانایی خودنوزایی در حفظ ذخایر سلول های بنیادی و قابلیت تمایزی خود در تکوین اسپرماتوزوآ به عنوان عامل اصلی حفظ باروری در نظر گرفته می شوند(7). هم چنین سلول های سرتولی به عنوان سلول های پرستار بیضه شناخته می شوند که وظیفه اصلی آن ها پشتیبانی فیزیکی، ایمنی و تغذیه ای برای رشد SSC ها است. این سلول ها به منظور کنترل تکثیر و تمایز SSC ها به طور مستقیم و از طریق ترشح فاکتورهای ویژه آندوکرین، پاراکرین و اتوکرین با آن ها ارتباط دارند(19). در نتیجه ارتباطات سلول های سرتولی و SSC ها یک ریز محیط مناسب را در بیضه ایجاد می کنند که می تواند تکوین و سرنوشت SSC ها را به اسپرم های عملکردی فراهم کند. تغییر این ریزمحیط تحت تأثیر عوامل محیطی هم چون میدان های الکترومغناطیس می تواند بر تعادل خود نوزایی و تمایز SSC ها تأثیر بگذارد و منجر به اختلال در اسپرماتوژنز شود(1). در عصر تکنولوژی و ارتباطات، منابع الکترومغناطیسی زیادی با فرکانس های مختلف در محیط اطراف ما وجود دارد. مطالعات مختلف در مورد تأثیر EMF در سیستم های بیولوژیکی نتایج متناقضی به همراه داشته است و نمی توان به طور دقیق اثر خنثی، منفی یا مثبت میدان الکترومغناطیسی را تأیید کرد(22). با این وجود مطالعات علمی بیشماری نشان داده اند که دستگاه تولید مثل مرد یکی از حساس ترین اندام ها در برابر تشعشات الکترومغناطیسی است و قرار گرفتن در معرض EMF به طرز منفی بر SSC ها و سلول های سرتولی و در نتیجه بر روند اسپرماتوژنز تأثیر می­گذارد(31). در مطالعات مختلف در مورد اثرات مضر EMF بر سطح استرس اکسیداتیو، تعداد سلول های آپوپتوزی و تغییرات هیستوپاتولوژیک بحث شده است(2). هم چنین، نتایج مشابه ای در پژوهش های قبلی ما گزارش شده است، در مطالعه ای اثر منفی EMF(50 هرتز) بر سلول های بنیادی اسپرماتوگونی و آسیب های اکسیداتیو ناشی از آن پس از گذشت دوهفته را گزارش کردیم که این آسیب ها پس از تیمار با اگزوزوم های مشتق از سرتولی کاهش قابل ملاحظه ای یافت. در پژوهشی دیگر، اثر زیان آور  EMFبر پارامترهای اسپرم و هورمون های جنسی موش ها را نشان داد(5). باتوجه به پیشینه مطالعات در پژوهش حاضر به بررسی و مقایسه اثر ویتامین C و اگزوزوم های مشتق از سلول های سرتولی در سلول های SSC پس قرار گرفتن در معرض میدان الکترومغناطیس 50 هرتز و شدت 5/2 میلی تسلا درطی 7 روز پرداخته شد. نتایج این بررسی نشان داد EMF باعث کاهش معنی دار زیستایی و توانایی کلون زایی SSC ها می شود. علاوه براین تصاویر فلورسنت DAPI نشان دهنده تغییرات در هسته و افزایش آپوپتوز در این سلول ها است. این نتایج با افزایش بیان کاسپاز 9 به عنوان یک شاخص آپوپتوز و هم چنین کاهش بیان ژن آنتی اکسیدانی SOD تأیید شد. محتمل ترین توضیح نتایج حاصل می تواند افزایش تولید و تجمع ROS القائ شده توسط EMF در سلول ها باشد که کاهش قابل ملاحظه SOD نیز بیان­گر این موضوع است و استرس اکسیداتیو ناشی از این عدم تعادل، منجر به اختلال در نیچ بیضه و عملکرد اسپرماتوژنز شود. هم چنین؛ نتایج مشابهی توسط مطالعات مختلف، نشان دهنده ظرفیت EMFدر تولید رادیکال های آزاد و نقش اساسی استرس اکسیداتیو در تنظیم مسیر آپوپتوز وابسته به کاسپاز و کاهش بقائ سلولی می باشد(32). مشابه یافته های ما، Koziorowska و همکاران گزارش دادند که قرار گرفتن در معرض EMF با فرکانس50 هرتز و شدت 5/2 میلی تسلا باعث کاهش بقائ و تکثیر در رده سلولی اسپرماتوگونی شده و نشان می دهد قرار گرفتن مداوم در معرض EMF ممکن است روند اسپرماتوژنز را تغییر دهد(21). مطالعه­ای در سال 2017 به مقایسه اثرات میدان الکترومغناطیسی پالسی و مداوم(50 هرتز) بر روی رده های سلولی اسپرماتوگونی موش از نظر ویژگی های سلولی و بیوشیمیایی در شرایط آزمایشگاهی پرداخت. نتایج این مطالعه نشان داد که EMF باعث القائ استرس اکسیداتیو و به دنبال آن توقف چرخه سلولی و آپوپتوز در سلول­های اسپرماتوگونی می شود(31). گزارش های اخیر حاکی از استفاده از ترکیباتی با خواص مفید برای حفظ روند اسپرماتوژنز در برابر اثرات مضر EMF است که می­تواند در زمینه درمان ناباروری امیدوار کننده باشد(27). در این پژوهش، ما اثر بهبودبخش ویتامین C و اگزوزوم های مشتق از سرتولی در سلول های اسپرماتوگونی پس قرار گرفتن در معرض EMF بررسی و مقایسه گردید. نتایج حاصل در این پژوهش افزایش زیستایی و توانایی کلونی زایی SSC ها در مقایسه با گروه EMF نشان داد. هم چنین افزایش بیان ژن SOD و کاهش ژن کاسپاز9 تاییدکننده اثر مثبت تیمارهای ویتامین C و اگزوزوم است که از طریق کاهش ROS و بهبود شرایط کشت است. در مطالعه ی اثر آلوئه ورا در بهبود تغییرات ناشی از EMF 50 هرتز بر تعادل ROS، فعالیت متابولیک، توقف چرخه سلولی و آپوپتوز را نشان داد (32)، که با یافته های این پژوهش مطابقت دارد. هم چنین، در مطالعات مختلف مشخص شده که غلظت بهینه ویتامین C در محیط کشت SSC احتمالاً از طریق تنظیم تولید ROS و بیان ژن های مرتبط با آپوپتوز می تواند تکثیر سلول های بنیادی را تقویت کند(22). علاوه براین، نقش محافظتی ویتامین C برای جلوگیری از آسیب های سلولی القائ شده توسط تشعشعات در فرآیند اسپرماتوژنز موش گزارش شده است(30). نتایج پژوهش حاضر نیز هم راستا با این مطالعات است و اثر حفاظتی و بهبودبخش این آنتی اکسیدان را تایید می کند، البته مقایسه ویتامین C با اگزوزوم های مشتق از سلول های سرتولی نشان دهنده اثر موثرتر اگزوزوم ها در بهبود آسیب های ناشی از EMF می باشد. احتمالاً اثر قابل ملاحظه اگزوزوم ها نسبت به آنتی اکسیدان ویتامین C وجود فاکتورهای پاراکرین و تغذیه ای مختلف موجود در این اگزوزوم ها است. از آن­جا که اگزوزوم ها حاوی ذخایر ویژه ای از فاکتورهای رشد، سایتوکاین ها، miRNA ها، mRNA ها، lncRNA ها، و غیره براساس سلول منشائ خود هستند(11). هم چنین، نقش موثر سلول های سرتولی و ارتباطات پاکراین آن ها در ریزمحیط مشخص شده است(12). پیوند سلول های سرتولی به عنوان یک روش موثر در درمان اختلالات اسپرماتوژنز شناخته شده است، زیرا این سلول ها قادر به ترمیم آسیب های نیچ SSC ها هستند(19). در نتیجه کاربرد وزیکول های خارج سلولی آزاد شده توسط سلول های سرتولی می تواند اثرات بهبود بخش زیادی را بر SSC ها اعمال کند که ناشی طیف گسترده ترکیبات و فاکتورهای موجود در آن است در مقایسه با یک آنتی اکسیدان هم­چون ویتامین C است. در سال­های اخیر کاربرد اگزوزوم های مشتق از سلول های بنیادی مزانشیمی توسط نویسندگان مختلفی با هدف پیشگیری و درمان اختلالات و بیماری های مختلف پیشنهاد شده است(38، 33، 17).

به طور خلاصه، پژوهش حاضر بیان­گر اثر مخرب میدان های الکترومغناطیس محیط اطراف ما بر سلول­های بنیادی اسپرماتوگونی و نیچ آن ها است. علاوه براین، نتایج ما از اثرات مفید ویتامین C و اگزوزوم های مشتق از سرتولی در بهبود آسیب های حاصل از EMF پشتیبانی می کند. به ویژه، اگزوزوم های مشتق از سرتولی با توجه به این که حاوی مجموعه ای از فاکتورهای موثر سلول­های سرتولی است دارای اثرات بهبود بخش بیشتری نسبت به ویتامین C بر این آسیب ها بود. براساس این یافته­ها اگزوزوم های مشتق از سرتولی را می توان به عنوان یک راهکار درمانی جدید و ایمن تر در جهت بهبود سلامت باروری مردان پیشنهاد کرد. با این حال، درک دقیق این مسیرهای سیگنالینگ با هدف حفظ باروری افرادی که به طور مداوم در معرض میدان های الکترومغناطیسی محیطی قرار دارند ضروری است.

تشکر و قدردانی

از همکاران مرکز تحقیقات بیولوژی کاربردی تکوین جانوری دانشگاه آزاد اسلامی واحد مشهد، صمیمانه سپاسگزاری می شود. 

1. Abumadighem, A., Solomon, R., Stepanovsky, A., Kapelushnik, J., Shi, Q., Meese, E. (2018). Development of spermatogenesis in vitro in three-dimensional culture from spermatogonial cells of busulfan-treated immature mice. Int J Mol Sci, 19(12); 3804.

2.Azab, AE., Khalat, AM., Ebrahim, SA. (2018). Electromagnetic fields and its harmful effects on the male reproductive electromagnetic fields and its harmful effects on the male reproductive system. Biosci Bioeng, 4; 1–13.

3.Azizi, H., Hamidabadi, HG., Skutella, T. (2018). Differential proliferation effects after short-term cultivation of mouse spermatogonial stem cells on different feeder layers. Cell J, 21;186–193.

4.Bahaodini, A., Owjfard, M., Tamadon, A., Jafari, SM. (2015). Low frequency electromagnetic fields long-term exposure effects on testicular histology, sperm quality and testosterone levels of male rats. Asian Pacific J Reprod, 4;195–200.

5.Baharara, J., Amini, E., Salek-abdollahi, F., Nikdel, N., Asadi-Samani, M. (2015). Protective effect of date palm pollen ( Phoenix dactylifera ) on sperm parameters and sexual hormones in male NMRI mice exposed to low frequency electromagnetic field( 50 Hz ). J HerbMed Pharmacol, 4; 75–80.

6.Baharara, J., Hosseini, N., Farzin, TR. (2016). Extremely low frequency electromagnetic field sensitizes cisplatin-resistant human ovarian adenocarcinoma cells via P53 activation. Cytotechnology, 68; 1403–1413.

7.David, S., Orwig, KE. (2020). Spermatogonial stem cell culture in oncofertility. Urol Clin North Am, 47; 227–244.

8.Ding, Z., Li, J., Li, F., Mephryar, MM., Wu, S., Zhang, C. (2017). Vitamin C and vitamin E protected B95-8 and Balb/c-3T3 cells from apoptosis induced by intermittent 50Hz ELF-EMF radiation. Iran J Public Health, 46; 23–34.

9.Duan, Y., Wang, Z., Zhang, H., He, Y., Lu, R., Zhang, R. (2013). The preventive effect of lotus seedpod procyanidins on cognitive impairment and oxidative damage induced by extremely low frequency electromagnetic field exposure. Food Funct, 4; 1252–1262.

10.Fathi, E., Farahzadi, R., Rahbarghazi, R., Kafil, HS., Yolmeh, R. (2017). Rat adipose-derived mesenchymal stem cells aging reduction by zinc sulfate under extremely low frequency electromagnetic field exposure is associated with increased telomerase reverse transcriptase gene expression. Vet Res Forum an Int Q J, 8; 89–96.

11.Fereshteh, Z., Schmidt, SA., Al-Dossary, AA., Accerbi, M., Arighi, C., Cowart, J. (2018). Murine oviductosomes (OVS) microRNA profiling during the estrous cycle: Delivery of OVS-borne microRNAs to sperm where miR-34c-5p localizes at the centrosome. Sci Rep, 8; 16094.

12.Fu, C., Rojas, T., Chin, AC., Cheng, W., Bernstein, IA., Albacarys, LK. (2018). Multiple aspects of male germ cell development and interactions with Sertoli cells require inositol hexakisphosphate kinase-1. Sci Rep, 8; 1–13.

13.Gassei, K., Orwig, KE. (2016). Experimental methods to preserve male fertility and treat male factor infertility. Fertil Steril, 105; 256–266.

14.Górski, R., Kotwicka, M., Skibińska, I., Jendraszak, M., Wosiński, S. (2020). Effect of low-frequency electric field screening on motility of human sperm. Ann Agric Environ Med, 27; 427–434.

15.Guney, M., Ozguner, F., Oral, B., Karahan, N., Mungan, T. (2007). 900 MHz radiofrequency-induced histopathologic changes and oxidative stress in rat endometrium: Protection by vitamins E and C. Toxicol Ind Health, 23; 411–420.

16.Gurunathan, S., Kang, M., Jeyaraj, M., Qasim, M., Kim, J. (2019). Review of the isolation, characterization, biological function, and multifarious therapeutic approaches of exosomes. Cells, 8; 307.

17.Huang, B., Lu, J., Ding, C., Zou, Q., Wang, W., Li, H. (2018). Exosomes derived from human adipose mesenchymal stem cells improve ovary function of premature ovarian insufficiency by targeting SMAD. Stem Cell Res Ther, 9; 1–12.

18.Javeed, N., Mukhopadhyay, D. (2017). Exosomes and their role in the micro-/macro-environment: A comprehensive review. J Biomed Res, 31; 386–394.

19.Kaur, G., Vadala, S., Dufour, JM. (2017). An overview of a Sertoli cell transplantation model to study testis morphogenesis and the role of the Sertoli cells in immune privilege. Environ Epigenetics, 3; 1–10.

20.Kesari, KK., Agarwal, A., Henkel, R. (2018). Radiations and male fertility. Reprod Biol Endocrinol, 16; 118.

21.Koziorowska, A., Kozioł, K., Gniady, S., Romerowicz-Misielak, M. (2018). An electromagnetic field with a frequency of 50 Hz and a magnetic induction of 2.5 mT affects spermatogonia mouse cells(GC-1spg line). Prz Elektrotechniczny, 94; 132–135.

22.Liu, C., Duan, W., Xu, S., Chen, C., He, M., Zhang, L. (2013). Exposure to 1800 MHz radiofrequency electromagnetic radiation induces oxidative DNA base damage in a mouse spermatocyte-derived cell line. Toxicol Lett, 218; 2–9.

23.Mancuso, F., Calvitti, M., Milardi, D., Grande, G., Falabella, G., Arato, I. (2018). Testosterone and FSH modulate Sertoli cell extracellular secretion: Proteomic analysis. Mol Cell Endocrinol, 476; 1–7.

24.Marjault, HB., Allemand, I. (2016). Consequences of irradiation on adult spermatogenesis: Between infertility and hereditary risk. Mutat Res - Rev Mutat Res, 770; 340–348.

25.Masaki, K., Sakai, M., Kuroki, S., Jo, JI., Hoshina, K., Fujimori, Y., Oka, K. (2018). FGF2 has distinct molecular functions from gdnf in the mouse germline niche. Stem Cell Reports, 10; 1782–1792.

26.Navid, S., Rastegar, T., Baazm, M., Alizadeh, R., Talebi, A., Gholami, K. (2017). In vitro effects of melatonin on colonization of neonate mouse spermatogonial stem cells. Syst Biol Reprod Med, 63; 370–381.

27.Pandey, N., Giri, S. (2018). Melatonin attenuates radiofrequency radiation(900 MHz)-induced oxidative stress, DNA damage and cell cycle arrest in germ cells of male Swiss albino mice. Toxicol Ind Health, 34; 315–327.

28.Salek, F., Baharara, J., Nejad Shahrokhabadi, K., Amini, E. (2015). The guardians of germ cells; the role of Sertoli-derived exosomes on electromagnetic field-induced oxidative stress in mouse spermatogonial stem cells in vitro. Int J Radiat Biol Under review.

29.Saygin, M., Ozmen, O., Erol, O., Ellidag, HY., Ilhan, I., Aslankoc, R. (2018). The impact of electromagnetic radiation(2.45 GHz, Wi-Fi) on the female reproductive system: The role of vitamin C. Toxicol Ind Health, 34; 620–630.

30.Sharma, G., Sisodia, R., Meghnani, E. (2015). Radiation induced testicular injury and its amelioration by prunus domestica in Swiss albino mice. Iran J Radiat Res, 13; 45–54.

31.Solek, P., Majchrowicz, L., Bloniarz, D., Krotoszynska, E., Koziorowski, M. (2017). Pulsed or continuous electromagnetic field induce p53/p21-mediated apoptotic signaling pathway in mouse spermatogenic cells in vitro and thus may affect male fertility. Toxicology, 382; 84–92.

32.Solek, P., Majchrowicz, L., Koziorowski, M. (2018). Aloe arborescens juice prevents EMF-induced oxidative stress and thus protects from pathophysiology in the male reproductive system in vitro. Environ Res, 166; 141–149.

33.Sun, L., Li, D., Song, K., Wei, J., Yao, S., Li, Z. (2017). Exosomes derived from human umbilical cord mesenchymal stem cells protect against cisplatin-induced ovarian granulosa cell stress and apoptosis in vitro. Sci Rep, 7; 1–13.

34.Wang, J., Cao, H., Xue, X., Fan, C., Fang, F., Zhou, J. (2014). Effect of vitamin C on growth of caprine spermatogonial stem cells invitro. Theriogenology, 81; 545–555.

35.Yahyazadeh, A., Deniz, ÖG., Kaplan, AA., Altun, G., Yurt, KK., Davis, D. (2018). The genomic effects of cell phone exposure on the reproductive system. Environ Res, 167; 684–693.

36.Yang, C., Yao, C., Tian, R., Zhu, Z., Zhao, L., Li, P. (2019). miR-202-3p Regulates sertoli cell proliferation, synthesis function, and apoptosis by targeting LRP6 and cyclin D1 of Wnt/β-catenin signaling. Mol Ther - Nucleic Acids, 14; 1–19.

37.Yin, K., Wang, S., Zhao, RC. (2019). Exosomes from mesenchymal stem/stromal cells: A new therapeutic paradigm. Biomark Res, 7; 1–8.

38.Zhang, W., Yang, C., Guo, W., Guo, X., Liu, C. (2018). Protective effect of bone marrow mesenchymal stem cells-derived exosomes against testicular ischemia-reperfusion injury in rats. J South Med Univ, 38; 910–916.

39.Zhang, XF., Choi, YJ., Han, JW., Kim, E., Park, JH., Gurunathan, S. (2015). Differential nanoreprotoxicity of silver nanoparticles in male somatic cells and spermatogonial stem cells. Int J Nanomedicine, 10; 1335–1357