تاثیر عصاره گیاه رازیانه بر فعالیت پروبیوتیک های موجود در مگس سرکه و بررسی تاثیر آن بر باروری مگس سرکه نر

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه ژنتیک، دانشکده زیست شناسی، دانشگاه آزاد اسلامی واحد تنکابن، تنکابن، ایران

2 گروه میکروبیولوژی، دانشکده زیست شناسی، دانشگاه آزاد اسالمی واحد تنکابن، تنکابن، ایران

3 گروه ژنتیک، دانشکده زیست شناسی، دانشگاه آزاد اسالمی واحد تنکابن، تنکابن، ایران

چکیده

زمینه و هدف: گزارشات متعددی مبنی بر تاثیر پروبیوتیک ها در افزایش باروری نیز وجود دارد. پروبیوتیک ها با فعالیت داخل روده گوارشی باعث تولید ویتامین ها و پروتئین های متعدد میشوند که جهت باروری در مگس ها و به طور کلی در ارگانیسم های مختلف نیازمند می باشد.در تحقیق حاضر تاثیر عصاره گیاه رازیانه بر باروری مگس سرکه و نقش پروبیوتیک ها در آن مورد بررسی قرار گرفته است.
روش کار: عصاره رازیانه به غلظت های مختلف 25، 50 و mg/ml 75 به محیط کشت اضافه شد. سپس تعداد اسپرم های مگس نر در زیر میکروسکوپ نوری با قرار دادن محیط A شمارش گردیدند. تعداد سلول های غده جنسی، سایز سلول ها و اندازه غده جنسی به کمک میکروسکوپ نوری مشاهده شدند، هم چنین میزان پروتئین های غدد جنسی نیز جداسازی و با روش  PCRبررسی و همه داده ها به کمک SPSS آنالیزگردید.
یافته ها: میانگین شمارش اسپرم ها 6440 و 3995 عدد، تعداد سلول های غده جنسی 3502 و 1364 عدد، سایز سلول های غده جنسی 0.0675 و 0.0286 میلی متر مربع،  سایز غده جنسی 0.339 و 0.391سانتی متر مربع، نتایج نشان داد که میزان پروتئین های جنسی 61/19 و 95/16 میکروگرم،به ترتیب در غلظت رازیانه(mg/ml ۷۵) و غلظت(mg/ml25) بودند، می باشد، نتایج آنالیز نشان داد که تاثیر معنی داری اثر رازیانه در افزایش باروری داشته است.با تکنیک PCR نیز یک باند تقریباً bp 300 بر روی ژل مشاهده گردید.
نتیجه­ گیری:نتایج تحقیق نشان داد زمانی که از غلظت بیشتر عصاره رازیانه( mg/ml75) در محیط کشت استفاده شد، میزان باروری در مگس سرکه نر بیشتر از غلظت کمتر(mg/ml 25) و هم چنین گروه کنترل بودند. در تحقیق حاضر وجود پروبیوتیک ها نشان دهنده تغییرات در محیط کشت و تاثیر آن در میزان باروری است.
 

کلیدواژه‌ها


عنوان مقاله [English]

The effect of fennel extracted on the probiotic activities in the Drosophila melanogaster and study on the reproductive performance of male Drosophila melanogaster

چکیده [English]

Inroduction & Objective: In the present study, the effect of fennel extract on Drosophila fertility and its role in probiotics were investigated.Probiotics with the activity of the gastrointestinal tract produce numerous vitamins and proteins that are needed for fertility in flies and in general in different organisms.
Material and Method:Fennel extracts were divided into different concentrations. Concentrations containing 25, 50 and 75 mg / ml were added to the culture medium then the number of male spermatozoa were counted under light microscopy to be placed in A medium. Numbers of accessory gland cells, cell size and accessory gland size were observed by light microscopy. Also, accessory gland proteins were isolated and all data were analyzed by SPSS. PCR technique was also performed.
Results: The mean number of sperm was 6440 and 3995, the number of accessory gland cells was 3502 and 1364, the size of accessory gland cells was 0.0675 and 0.0286 mm 2, the size of accessory gland was 0.339 and 0.391 cm 2, respectively. The protein of accessory gland 19/16 and 16/95 μg, respectively, were in the concentration of fennel (75 mg / ml) and concentration (25 mg / ml), respectively. The results of analysis showed that fennel had a significant effect on increasing fertility. It showed that a band of approximately 300 bp was observed on the gel.
Conclusion: The results showed that when the higher concentration of fennel extract (75mg / ml) was used in the culture medium, the fertility rate in male Drosophila was higher than the lower concentration (25mg / ml) and in the control group. In the present study, the presence of probiotics indicates changes in the culture medium and its effect on fertility rate.

کلیدواژه‌ها [English]

  • Male Drosophila melanogaster
  • Fennel
  • Probiotic

مقدمه

 

گیاه رازیانه یک گیاه شناخته شده داروئی منطقه مدیترانه است(19). این در مناطق مختلف اروپا و آسیا کشت شده و از هند، چین و مصر به کشورهای دیگر وارد شده است. میوه رازیانه دارای سابقه طولانی در استفاده به عنوان غذا و دارو مصرف می گردد. به طور سنتی، اعتقاد بر این است که این گیاه به عنوان یک نیروی گرانشی(کمک به کنترل نفخ شکم) و افزایش تولید شیر مادر عمل می کند(31، 25). محققین گزارش نموده اند که این گیاه هم چنین می تواند افزایش میل جنسی، تسریع تولد، تسکین علائم بالینی مردان، ترویج جریان قاعدگی و تسکین معده و سرفه موثر باشد(20). محتویات دانه رازیانه شامل ترانس آنتول، استراگوئل، فنچون و α-phellandrene است و غلظت نسبی این ترکیبات بطور قابل توجهی بسته به وضعیت فنولوژیکی و منشاء گیاه متفاوت است(26).رازیانه از دیرباز به عنوان یک عامل استروژنی با سمیت کم و عدم وجود سرطان زایی به اثبات رسیده است، بنابراین می توان آن را مجدداً برای کاربرد در پزشکی مدرن معرفی کرد. علاوه بر این، ضد التهاب، ضد دیابتی، ضد تومور و بسیاری از فعالیت های دیگر این گیاه در مطالعات مختلف نشان داده شده است(23). رازیانه دارای تاریخچه ای طولانی به عنوان یک عامل استروژنی با سمیت کم و عدم وجود سرطان زایی مستند است. بنابراین می توان دوباره به استفاده مدرن پزشکی معرفی کرد. علاوه بر این، ضد التهاب، ضد دیابتی، ضد تومور و بسیاری از فعالیت های دیگر این گیاه در مطالعات مختلف نشان داده شده است. مطالعه نشان داد که عصاره دانه رازیانه در غلظت 100 و 200 میلی گرم بر میلی لیتر می­تواند تعداد فولیکول های مختلف تخمدان را به طور چشمگیری افزایش دهد(36). ناباروری یک مشکل عمده و چندملیتی در سراسر جهان است که شیوع آن در کشورهای توسعه یافته و در حال توسعه افزایش می یابد. این مشکل که حدود 15 درصد از زوج های جوان را شامل می شود، به عنوان عدم توانایی در دستیابی به یک حاملگی زنده در طی یک سال از مقاربت منظم و محافظت شده تعریف می شود(33). امروزه روش های درمانی مختلف مانند داروها، جراحی و تکنیک های مختلف ART استفاده می شود، اما این روش ها همیشه به حاملگی موفقیت آمیز نمی انجامد(24). با توجه به هزینه و هزینه­های اجتماعی، برخی از زوج ها به دنبال روش های جامع درمان جایگزین مانند طب سنتی گیاهی هستند. گزارش شده است که حدود 40٪ موارد ناباروری به علت مشکلات زنانه می باشد. این عوامل عبارتند از اندومتریوز، سندرم تخمدان پلی کیستیک و اختلال عملکرد تخمک گذاری بیش از 40 درصد ناباروری در زنان را تشکیل می­دهد(35). اکثر پروبیوتیک ها به عنوان مکمل های زنده در رژیم غذایی عرضه می شوند که توانایی عبور از مسیر روده را دارد(17) .تغذیه مستقیم باکتری های پروبیوتیک منجر به تولید ویتامین، دسترسی به مواد معدنی و عناصر کمیاب و تولید آنزیم های مهم گوارشی می شود. استفاده از پروبیوتیک ها برای افزایش پارامترهای زیستی رشد و بهبود توانایی مقاومت در برابر بیماری ها در انسان به خوبی شناخته شده است(22، 18). اما تحقیقات مختلفی در مورد پروبیوتیک های تغذیه ای در عملکرد تولید مثل وجود دارد، در تحقیق حاضر هدف بررسی تاثیر پروبیوتیک ها در افزایش عملکرد تولید مثلی هنگامی که از عصاره رازیانه استفاده می شود، می باشد. پروبیوتیک ها علاوه بر این که در تولید ویتامین های مختلف روده دخالت دارند در تولید پروتئین ها نیز نقش موثری ایفا می کنند. تحقیقات متعددی آن را به اثبات رسانده است. پروتئین خام و محتوای چربی در تمام مواد غذایی مورد آزمایش با مقادیر توصیه شده(پروتئین خام 45/30 درصد و چربی خام 8/4 درصد) بود. پیوستن زیست توده باکتریایی به پایه خوراکی احتمالاً سبب افزایش محتوای پروتئین همه پروبیوتیک های خوراکی(T1، T2، T3 و (T4  نسبت به خوراک کنترل می باشد. روده حاوی انواع بسیاری از باکتری ها(مفید، مضر وخنثی) است که باید توازن باکتری های روده در بدن برقرار باشد در غیر این صورت علاوه بر مختل شدن وظایف فلور روده باعث آکنه، آلرژی غذایی، خستگی مفرط، افسردگی، سردرد و غیره می شود. از دیرباز وجود پروبیوتیک ها در روده مگس سرکه به اثبات رسیده است. معمولاً پروبیوتیک های موجود در روده مگس سرکه از جنس لاکتوباسیلوس هستند که آن ها را از آلودگی به بسیاری از میکروب ها و قارچ ها از جمله قارچ آسپرژیلوس ممانعت می کند(34). در این ارتباط از بین گیاهان مختلف عصاره رازیانه در درمان بسیاری از ناهنجاری های تولید مثلی و ناباروری ها موثر می باشد. این گیاه به دلیل وجود مواد تراتوژنیک به همراه عصاره محیط کشت مگس سرکه جهت دارو در افزایش باروری موثر است. به طور کلی با در نظر گرفتن عصاره رازیانه به عنوان یک گیاه که در افزایش باروری به اثبات رسیده چه مقدار می تواند با کمک پروبیوتیک ها در افزایش باروری موثر باشد با در نظر گرفتن شاخص باروری در مگس سرکه که در منابع علمی موجود است. بسیاری از پژوهشگران اثرات رازیانه را روی دستگاه تناسلی جنس ماده و غدد پستانی، به خواص استروژنی آنتول موجود در اسانس نسبت می دهند و معتقد هستند که پلیمرهای آنتول مانند دیآنتول و فتوآنتول به عنوان فیتواستروژن عمل می­نمایند(36، 14، 6). میوه و اسانس رازیانه به دلیل دارا بودن آنتول، موجب کاهش یا توقف اسپاسم های دستگاه گوارش و تشدید ترشح شیره گوارشی و در نتیجه بالا رفتن کیفیت هضم می­گردد. اکثـر پروبیوتیـک هـا متعلـق بـه گـروه بزرگی از باکتری های اصـلی فلـور میکروبـی روده انسـان بوده و در آن جا زندگی همسفرگی بی ضرری دارنـد(3، 1). در تحقیقی که توسط Shin  و همکاران سال 2011 انجام دادند، از پروبیوتیک ها در عملکرد دروزوفیلا استفاده شد(30). در این تحقیق مشخص گردید که میکروب های روده که از سویه های مختلف باکتری ها هستند در روده دروزوفیلا زندگی می کنند و به سنتز ویتامین ها نیز کمک می نمایند. از میکروب هایی که در این تحقیق به عنوان پروبیوتیک استفاده شده است می توان به لاکتوباسیلوس فرمنتوم اشاره نمود. در این ارتباط جهت اطلاع از ارتباط بین این باکتری و تاثیر اسید فرومیک بر رشد دروزوفیلا، میزان تغییرات وزنی بعد از 7 تا 8 روز مصرف این ماده در سطح معنی داری بود(30، 10). هدف اساسی از تحقیق حاضر افزایش میزان باروری مگس سرکه نر به کمک عصاره رازیانه موجود در محیط کشت و هدف فرعی وضعیت پروبیوتیک های موجود در محیط کشت و در واقع تغییراتی که در محیط کشت ایجاد می­شود با تجزیه و تحلیل نتایج حاصله می باشد. در این ارتباط به سوال آیا ارتباطی بین عصاره محیط کشت حاوی رازیانه و پروبیوتیک ها با میزان باروری مگس نر وجود دارد، پاسخ داده خواهد شد.

مواد و روش کار

الف- مطالعات و جمع آوری منابع و اطلاعات لازمه

در این ارتباط منابع و اطلاعات لازم در مورد نقش پروبیوتیک ها و تغییراتی که در محیط کشت مگس می­تواند ایجاد کند مورد مطالعه قرار گرفت. عصاره گیری به روش ماسراسـیون انجام شد(32). برای این کار ابتدا بعد از پوشاندن سر ارلن ها با ورقه آلومینیومی به مدت 48 ساعت بر روی دستگاه شیکر با نود دور در دقیقه قرار گرفتند. بعد از این که حلال و گیاه همگن شدند محلول ها توسط کاغذ صافی واتمن صاف و سپس محلول روی بن مـاری قـرار داده شـد تا حلال از عصاره خارج شود. پس از تبخیر حلال، عصاره خشک حاصل شد، که به ازای هر 100 گرم رازیانه، 14 گرم عصاره به دست آمد. مقادیر مورد نیاز از عصاره، بـه کمـک ترازوی حساس 001/0 میلی گرمی توزین و در مقدار معینی از محیط کشت حل گردید تا عصاره با غلظت مورد نیاز بـه دسـت آید.

ب- اضافه نمودن عصاره گیاه به محیط کشت مگس سرکه

در این ارتباط عصاره رازیانه با غلظت های 25، 50 و 75 میلی گرم بر میلی لیتر(25 میلی گرم عصاره پودر شده با 25 سی سی آب)(37) به محیط کشت مگس اضافه و تاثیر آن در میزان باروری مگس سرکه مورد بررسی قرار گرفت. با توجه به نسبت 100 گرم گیاه رازیانه 14 گرم عصاره خشک حاصل می شود، نسبت زیر در تحقیق حاضر استفاده شد100 میلی گرم برای 14 میلی گرم، برای 25 میلی گرم چه مقدار مورد نیاز است؟با توجه به نسبت 100 به 14، 179 میلی گرم برای 25 میلی گرم عصاره خشک مورد نیاز است همین طور برای سایر غلظت ها رعایت شد.هم چنین محیط کشت مگس سرکه؛ شامل آگار، ساکارز، آرد گندم، مخمر، اسید پروپیونیک، عصاره رازیانه در غلظت های مختلف و آب در ویال های 10 سی سی آماده شدند. در ارتباط با غلظت های مختلف عصاره رازیانه از غلظت های 25، 50 و 75 میلی گرم بر میلی لیتر به همراه گروه شاهد که فاقد عصاره گیاه رازیانه بود استفاده گردید. ویال های حاوی محیط کشت هر 10 تا 15 روز عوض شده و مگس ها به محیط کشت جدید پاساژ داده شدند. در تحقیق حاضر جهت بررسی تاثیر عصاره گیاه رازیانه در افزایش باروری مگس ها، پرورش مگس سرکه در ویال های 10 سی سی انجام شد. در این ارتباط مگس ها به دوگروه کنترل(بدون عصاره رازیانه)و محیط کشت حاوی عصاره رازیانه تقسیم بندی شدند. پارامترهای مرتبط با مگس نر نیز مورد بررسی قرار گرفت، این پارامترها شامل سایز غدد جنسی مگس سرکه نر، تعداد سلول های غدد جنسی و سایز غدد جنسی جداسازی شد. با توجه به این که تعداد سلول های شمارش شده از هر غده جنسی به کمک میکروسکوپ نوری انجام گردید، میزان شمارش اسپرم ها(Sperm count) مورد بررسی قرار گرفت در این ارتباط بعد از جفت گیری مگس های نر و ماده از بخش لوله اسپرمات که(Spermatechae) (محل ذخیره اسپرم در دستگاه تناسلی ماده)که اسپرم ها در آن ذخیره شده است، اسپرم ها را خارج نموده و به کمک محلول Beadle-Ephrusi salin که شامل128.3 mM NaCl, 4.7 mM KCl, 23 mM CaCl2) ) می باشد(4). شمارش اسپرم ها صورت گرفت. هم چنین شمارش اسپرم به کمک میکرسکوپ نوری با بزرگ نمایی 10 انجام شدند. علاوه بر آن شمارش سلول های جنسی مگس سرکه نیز انجام گردید. جهت شمارش این سلول ها ابتدا غده جنسی مگس در محیط آ (Medium A(2)  قرار داده شدند، ترکیبات این بافر شامل 0.03 M NaEPO4 buffer (pH 6.8), 0.04 M KC1, 0.011 M NaCl, 0.003 M  CaC12, 0.021 M MgC12می باشد. بعد از این که تحت این تیمار به مدت 30 ثانیه قرار گرفتند بر روی لام منتقل و با بزرگ نمایی 10 شمارش سلول های غدد جنسی انجام شد. در این ارتباط سلول های غده جنسی به محلول 2درصد لاکتواستواورسئین به مدت 20 دقیقه منتقل، سپس غده جنسی به کمک یک سرنگ بهداشتی بر روی لام و به کمک لامل فیکس شدند. میانگین تعداد هر سلول غده جنسی برای 50 غده جنسی شمارش گردید ،هم چنین سایز سلول های جنسی نیز به کمک میکرومتر در زیر میکروسکوپ نوری با بزرگنمائی 10 به طور تقریبی شمارش گردید. هم چنین هم زمان با شمارش سلول های غدد جنسی، سایز غده جنسی نیز در زیر میکروسکوپ اندازه گیری شد. اشکال غدد جنسی در زیر میکروسکوپ معمولاً به صورت حروف ‘s’, ‘c’, or ‘j’ انگلیسی می­باشد. در این خصوص هر غده جنسی به کمک یک دوربین دیجیتالی عکس برداری شد. جهت محاسبه محیط غده جنسی، غده جنسی به سه قسمت مستطیل، مثلث و لوزی شکل تقسیم و بر اساس فرمول محاسبه توسطRavi Ram and Ramesh  سال2002 به دست آمده است. تمامی آزمایشات برای چهار گروه مورد مطالعه شامل مگس های تحت تیمار عصاره رازیانه در غلظت های 25، 50 و 75 میلی گرم و گروه کنترل تقسیم بندی شده بودند، انجام شد(28).

ج- بررسی محیط کشت مگس سرکه از نظر وجود و میزان فعالیت پروبیوتیک ها در آن به عنوان شاخص مورد بررسی در این مطالعه:

 در این ارتباط ترکیبات محیط کشت در حالت بدون استفاده از عصاره رازیانه و با استفاده از عصاره مورد بررسی قرار گرفت. در خصوص محیط کشت دارای دروزوفیلا به دو گروه تقسیم می گردد این دو گروه شامل گروه دارای عصاره رازیانه(غلظت های 25، 50 و 75 میلی گرم بر میلی لیتر) و غیر رازیانه(گروه کنترل) می باشد. در هر دو مورد ذکر شده به کمک PCR وجود پروبیوتیک­ها مورد برررسی قرار گرفتند.در این ارتباط با توجه به غلظت­های استاندارد شده در مورد DNA الگو،(dNTP) ، آغازگرها و Taq DNA Polymerase ، واکنش زنجیره­ای پلی مراز با دستگاه  ترموسایکلر انجام شد، بهینه سازی شرایط PCR با انجام تغییرات در غلظت های DNA الگو، تغییر دادن دمای اتصال با انجام برنامه دمایی گرادیانت و هم چنین غلظت آغازگرها و تعداد چرخه­های واکنش و زمان گسترش در واکنش PCR انجام شد. هم چنین طراحی پرایمر به منظور تهیه  DNA و تعیین توالی ژن 16S rDNAمربوط به باکتری Lactobacillus brevis  در ابتدا بوسیله برنامه کامپیوتریDNAMAN و با توجه به اطلاعات توالی مربوط به ژن مورد نظرکه در بانک جهانی ژن وجود داشت صورت گرفت .برای این کار جفت پرایمر زیرتقریباً از ابتدا تا انتهای ژن طراحی گردید(جدول 1).

بررسی محصول PCR

روشی که بررسی محصولات PCR را به طور کیفی یا کمی از نظر وجود یا عدم وجود و یا مقدار تولید محصول را با استفاده از آن مورد ارزیابی قرار می دهد الکترو فورز محصول PCR در ژل آگارز است. غلظت های مختلفی از این ژل جهت بررسی DNA مورد نظر استفاده می شود که این غلظت ها معمولاً  بین 5/0 تا 5 درصد می باشد.در اینجا از غلظت1 تا5/1 درصد آگارز استفاده گردید.در این ارتباط کیفیت محصولات PCR بسیار مناسب بود(جدول 2و 3).

تجزیه و تحلیل آماری

در تحقیق حاضر با کمک نرم افرار SPSS Version 20 داده های مربوط به تاثیر عصاره رازیانه بر افزایش باروری مگس سرکه مورد تجزیه و تحلیل قرار گرفت. هم چنین جهت رسم نمودار با برنامه اکسل و داده های آماری میزان تاثیر عصاره رازیانه بر میزان باروری مگس های سرکه مورد بررسی قرار گرفتند.

نتایج

جمع آوری و پرورش مگس ها

نتایج نشان داد که تعداد سلول های غده جنسی زمانی که تحت تیمار مگس ها با رازیانه بودند 339/0 در مقایسه با گروه کنترل 382/0 بود. هم چنین در خصوص سایز سلول های غده جنسی، 0675/0در مقایسه با گروه کنترل 028/0 است. علاوه بر آن تعداد سلول های جنسی 1364 زمانی که از عصاره رازیانه استفاده شده در مقایسه با گروه کنترل 3600 بودند. تعداد اسپرم های مگس سرکه نیز زمانی که از عصاره رازیانه استفاده شده 6440 در مقایسه با گروه کنترل 3900 عدد اسپرم بود(جدول 4 و شکل 1). علاوه بر آن نتایج داده های تعداد سلول های غده جنسی، سایز سلول های غده جنسی، تعداد سلول های جنسی و تعداد اسپرم های مگس سرکه با برنامه SPSS و آنالیز One way ANOVA و Post hoc Tuckey Test انجام شد، نتایج آنالیز نشان داد که تاثیر معنی داری بین میزان سایز غده جنسی، تعداد سلول ها، سایز سلول ها و تعداد اسپرم ها زمانی که با عصاره با غلظت 75 میلی گرم بر میلی لیتر استفاده شد، مشاهده گردید. (جدول 4 و شکل 1). با توجه به نتایج پارامترهای مربوط به غدد جنسی، میزان پروتئین های موجود در غدد جنسی (Quantity of accessory gland ) ، نیز مورد بررسی قرار گرفتند، نتایج نشان داد که میزان پروتئین های جنسی زمانی که از عصاره رازیانه به مقدار 75 میلی گرم بر میلی لیتر استفاده شد 61/19میکروگرم بر غدد جنسی مگس نر در مقایسه با 02/16 مربوط به گروه کنترل بودند(جدول 4). هم چنین با برنامه SPSS و آنالیز ANOVA و Post hoc Tuckey Test انجام شد، نتایج آنالیز نشان داد که تاثیر معنی داری بین میزان پروتئین های جنسی و مصرف رازیانه وجود دارد(جدول 4). همان طور که در شکل 1 مشاهده می شود، گروه با غلظت عصاره ۷۵ میلی گرم بر میلی لیتر دارای سایز سلول و سایز غده جنسی می­باشد.(اندازه سلول و غده جنسی با میکروسکوپ اندازه گیری شده است). در نمودار1 میزان تاثیر عصاره رازیانه بر سایز غده جنسی و سایز سلول های غده جنسی با غلظت­های مختلف شامل گروه کنترل، گروه باغلظت 25، 50 و 75 میلی گرم بر میلی لیتر که هر چقدر غلظت رازیانه در محیط کشت بیشتر می شود سایز غده و سایز سلول ها بیشتر می شود. هم چنین نمودار2 میزان تاثیر عصاره رازیانه بر تعداد اسپرم و تعداد سلول های غده جنسی با غلظت­های مختلف شامل گروه کنترل، گروه باغلظت 25، 50 و 75 میلی گرم بر میلی لیتر نشان داده شده است که هر چقدر غلظت عصاره در محیط کشت بیشتر می شود تعداد اسپرم و تعداد سلول های غده جنسی بیشتر می شود. علاوه بر آن در نمودار 3 میزان تاثیر عصاره رازیانه بر مقدار کمی پروتئین های غده جنسی با غلظت های مختلف شامل گروه کنترل، گروه باغلظت 25، 50 و 75 میلی گرم بر میلی لیتر که هر چقدر غلظت عصاره رازیانه در محیط کشت بیشتر می شود مقدار کمی پروتئین های غده جنسی بیشتر می شود.

نتایج آنالیز واکنش PCR

در تحقیق حاضر به منظور شناسایی باکتری های لاکتوباسیلوس موجود در محیط کشت مگس سرکه استخراج DNA انجام شد. واکنش PCR بر روی ژل آگارز 1.5 درصد ران شد(شکل 2). همان طور که در شکل مشاهده می شود محصولات PCR کیفیت نسبتاً خوبی داشته اند. در این ارتباط 15 نمونه از باکتری هایی که DNA آن ها استخراج شده بودند، واکنش PCR انجام شد. این نمونه ها از هر چهار گروه مورد مطالعه شامل نمونه با غلظت 75 میلی گرم بر میلی لیتر(نمونه 1 تا 5 )، 50 میلی گرم بر میلی لیتر(نمونه 6 تا 10 ) 25 مبلی گرم بر میلی لیتر (نمونه 11 تا 14) و نمونه تحت کنترل(نمونه15) تقسیم بندی شده اند. همانطور که در شکل مشاهده می شود نمونه شماره15 با توجه به این که فاقد باکتری لاکتوباسیلوس می ذباشدو هیچ محصولی مشاهده نشد.

 

جدول 1-پرایمرهای مورد استفاده برایانجام PCR

tgtaaaacgacggccagtccaaggatgctgtgtagataag

>16S rDNA For         

 

caggaaacagctatgacctcaggaaagccagccccatgtc

>16S rDNA Rev         

 

   300bp

Product size   

 

جدول 2- مواد لازم جهت انجام PCR

3.0 µl

Template DNA:

0.5 µl

Forward primer (100ng/ µl)

0.5 µl

Reverse primer (100ng/ µl)

1.0 µl

dNTP mix (2.5mM each)

2.5 µl

10X buffer

2.5 µl

Mgcl2

0.3 µl

Taq enzyme (3U/ µl)

15 µl

Water

25.0 µl

Total Reaction volume

 

جدول 3-برنامه لازم جهت انجام PCR

94           95°C       55/5°C   72°C       72°C

 

5 min      30 sec     40 sec     30sec      10 min

 

 

40 Cycles

جدول4-میانگین سایز غده جنسی، تعداد سلول های غدد جنسی، سایز سلول های جنسی ، مقدار کمی غده جنسی و تعداد اسپرم با توجه به میزان غلظت عصاره رازیانه

 

تیمار( (mg/ml

تعداد سلول

اندازه سلول(mm)

اندازه غده(cm)

میزان پروتئین غده(میکروگرم)

تعداد اسپرم

75

1364± 8.86a

0.0675±0.002a

0.39± 0.0001 a

19.631±1.5a   

6440.01±100a

50

2592±15.43b

0.0475±0.001b

0.39 ± 0.0005a

17.73± 1.3b   

4776.42±120b

25

3502± 20.88c

0.0286±0.001c

0.39±0.0008a

16.95± 1.2c

3995.82±90c

Control

3600± 20.80c

0.0280±0.001c

0.382±0.0008a

3900.82±90c

16.02± 1.1b      

 

 

 

 

 

 

 

 

 

 

شکل 1- تصویر سایز غده جنسی و سایز سلول های غده جنسی مگس سرکه

گروه کنترل(D)، گروه تیمار با  25میلی گرم بر میلی  لیتر(C)، 50 میلی گرم بر میلی لیتر(B) ، 75 میلی گرم بر میلی لیتر(A).

 

 

 

نمودار1 - نمودار میزان تاثیر عصاره رازیانه بر سایز غده جنسی و سایز سلول های غده جنسی با غلظت های مختلف

 

 

 

 

 

نمودار2- نمودار میزان تاثیر عصاره رازیانه بر تعداد اسپرم و تعداد سلول های غده جنسی با غلظت های مختلف

 

 

 

نمودار3- نمودار میزان تاثیر عصاره رازیانه بر مقدار کمی پروتئین های غده جنسی با غلظت های مختلف

 

 

شکل 2- نتایج محصول PCR مربوط به ژن 16SrDNA. همان طور که در شکل مشاهده می شود سایز 300 جهت بازی با کیفیت نسبتا خوبی وجود دارد. چهار گروه مورد مطالعه شامل نمونه با غلظت 75 میلی گرم بر میلی لیتر(نمونه 1 تا 5 )، 50 میلی گرم بر میلی لیتر(نمونه 6 تا 10 ) 25 مبلی گرم بر میلی لیتر (نمونه 11 تا 14) و نمونه تحت کنترل(نمونه15) تقسیم بندی شده اند. همانطور که در شکل مشاهده می شود نمونه شماره15 با توجه به این که فاقد باکتری لاکتوباسیلوس میب اشدو هیچ محصولی مشاهده نشد.و m مارکر مشخص کننده سایز محصول.


بحث و نتیجه گیری

در خصوص ارتباط بین افزایش باروری مگس سرکه و مصرف رازیانه و نقش پروبیوتیک ها در آن تاکنون در مقالات مختلف گزارش نشده است. تحقیقات مختلفی در خصوص اثر عصاره گیاهان داروئی بر میزان تولید مثل دروزوفیلا گزارش شده است(27، 5). از پارامترهایی که در بحث باروری مطرح می باشد شامل تولید اسپرم و میزان فعالیت غدد جنسی مگس میباشد(21). بنابراین در تحقیق حاضر با هدف نقش رازیانه وجود پروبیوتیک ها در افزایش باروری مگس ها مورد مطالعه قرار گرفته است، در این ارتباط مگس ها تحت تیمارهای مختلف رازیانه در محیط کشت قرار گرفته و با گروه کنترل مورد مقایسه قرار گرفتند. با توجه به این که معیار افزایش باروری در مگس نر شمارش تعداد اسپرم ها و افزایش سایز سلول های غدد جنسی و افزایش سایز غده جنسی می باشد، مورد بررسی قرار گرفتند. تمامی پارامترهای مورد بررسی زمانی که از غلظت های مختلف رازیانه استفاده شد، بیشتر از گروه کنترل بودند. محققین مختلفی ارتباط بین تغییرات در سلول های غدد جنسی و مصرف غلظت های مختلف عصاره های گیاهی را مورد بررسی قرار دادند. در این ارتباط از عصاره چای سبز به دلیل داشتن پلی فنل باعث کاهش سایز سلول های غدد جنسی، کاهش تعداد سلول­های غدد جنسی و هم چنین کاهش سایز غدد جنسی مگس نر شدند(16، 15، 13، 12). Gavilan و همکاران در سال 2016 گزارش نمودند ارتباط تنگاتنگی بین پروبیوتیک ها، میکروب های روده، جیره غذایی و فیزیولوزی میزبان وجود دارد. با توجه به این که این تحقیقات بر روی جوندگان نیز که پروبیوتیک ها در مگس می توانند باعث افزایش باروری مگس های ماده شوند ولی در مورد انسان ها هنوز هیچ گارانتی وجود ندارد که موثر باشد یا نه. همه این فاکتور ها می تواند دلیلی واقع­بینانه بر تاثیر آن بر روی انسان نیز باشد. در خصوص مگس سرکه Gavilan و همکاران در سال 2016 گزارش نمودند، پروبیوتیک ها می تواند در این ارتباط با افزایش تخم گذاری و افزایش بیرون آمدن شفیره ها (pupa ability) و تبدیل به مگس نقش داشته باشند. که در آن وجود دو سویه باکتری بیفیدو باکتریوم و لاکتوباسیلوس در ایجاد تغییرات در محیط کشت موثر هستند(29). نکته مهم این که در مورد سویه لاکتوباسیلوس بررسی های مولکولی نشان داده است که سویه جداشده از محیط کشت یک سویه ایزوژنیک نسبت به سایر سویه های لاکتوباسیلوس می باشد(7). بنابراین یک سویه یونیک پروبیوتیک در محیط کشت نقش آن در میزان باروری مگس سرکه می تواند میزان ارتباط بین وجود پروبیوتیک­ها و افزایش باروری را تحت تاثیر قرار دهد. در تحقیق حاضر از عصاره رازیانه استفاده شده است. گزارشات متعددی مبنی بر تاثیر عصاره رازیانه در افزایش باروری در حیوانات مختلف وجود دارد. رازیانه در طب سنتی به عنوان یک ادویه استفاده می شود. فعالیت های دیورتیک، ضد درد و ضد تب، هم چنین در فعالیت های آنتی اکسیدانی و میوه رنگرزی یافت شده است(9). در این ارتباط عصاره رازیانه به غلظت های مختلف تقسیم بندی شدند. غلظت ها شامل 25، 50 و 75 میلی گرم بر میلی لیتر به محیط کشت اضافه شد. مگس های سرکه طی دوماه مورد مطالعه قرار گرفتند و نتایج موید تاثیر عصاره رازیانه در افزایش باروری آن ها داشتند. گزارشات متعددی مبنی بر تاثیر پروبیوتیک ها در افزایش باروری نیز وجود دارد. پروبیوتیک ها با فعالیت داخل روده گوارشی باعث تولید ویتامین ها و پروتئین های متعدد میشوند که جهت باروری در مگس ها و به طور کلی در ارگانیسم های مختلف نیازمند می باشد. Sharon و همکاران سال 2011 طی بررسی به محیط کشت مگس سرکه دو سویه از باکتری لاکتوباسیلوس پلانتاروم و استوباکتر پوموروم تلقیح کردند و تاثیر افزایش باروری را مشاهده کردند(35). در نتایج ما چندین پارامتر در نظر گرفته شد این پارامترها شامل تعداد اسپرم ها، تعداد سلول های غدد جنسی، اندازه سلول ها و سایز غدد جنسی مورد بررسی قرار داده شد. نتایج تحقیق نشان داد زمانکه از غلظت بیشتر عصاره رازیانه(75میلی گرم بر میلی لیتر) در محیط کشت استفاده شد، میزان باروری در مگس سرکه نر بیشتر از غلظت کمتر(25 میلی گرم بر میلی لیتر) و هم چنین گروه کنترل بودند. علاوه بر آن با انجام واکنش PCR، وجود باکتری لاکتوباسیلوس تایید گردید. این باکتری به عنوان یک باکتری پروبیوتیک و مفید در روده مگس وجود دارد که حین تغذیه مگس از محیط کشت وارد محیط کشت شده و در حین تغییرات سیکل مگس(تبدیل تخم به لارو، شفیره و نهایتا مگس بالغ، تبادل باکتریائی انجام می شود(11). با توجه به تحقیق حاضر پیشنهاد می شود از عصاره سایر گیاهان که در بیماری های مختلف نظیر دیابت نوع دو ، سندرم پلی کیستیک تخمدان و بسیاری از سرطان ها بکار میروند با آزمایش بر روی مگس سرکه وضعیت تاثیر این عصاره ها در مگس سرکه و مقایسه آن با گروه کنترل مورد بررسی و نتیجه گیری قرار گیرد. علاوه بر آن می توان با استخراج عصاره محیط کشت در طی مسیر داروسازی، داروئی با اثربخشی بالاتر سنتز و به بازار عرضه نمود.در تحقیق حاضر نقش پروبیوتیک ها در افزایش باروری مگس سرکه مورد بررسی قرار گرفته است. همان طور که سایر محققین گزارش نمودند، وجود پروبیوتیک­ها در افزایش باروری مگس سرکه تاثیرگذار است. در این خصوص چند نکته مورد بررسی قرار گرفته است. احتمالاً وجود پروبیوتیک ها در افزایش تولید پروتئین خصوصاً پروتئین های جنسی موثر در افزایش باروری دخالت دارند(8).  و نکته بعدی این که پروبیوتیک ها در افزایش فاکتورهای مرتبط با هضم و جذب و به طور کلی در تغذیه مناسب می تواند موثر باشد و وجود عصاره رازیانه می­تواند یک هم افزایی را در باروری داشته باشد. نکته سوم این که پروبیوتیک ها می توانند تا حدودی در برابر عفونت ها و قارچ های احتمالی موجود در محیط کشت مقاومت نشان داده و به طبع کمک شایانی به رشد و بقا دروزوفیلا داشته باشد. با توجه به تحقیق حاضر پیشنهاد می شود از عصاره سایر گیاهان که می توانند در پیشگیری از بسیاری از بیماری ها موثر باشند نیز در محیط کشت دروزوفیلا استفاده نمود و اثرات آن را در دروزوفیلا مورد بررسی قرار داد. علاوه بر آن پیشنهاد می شود با استخراج عصاره محیط کشت حاوی پروبیوتیک و رازیانه بتوان داروئی موثر برای افراد بیمار تهیه کرد.

1.Asare, R. Akimana, C. Jones, S.  Abu Kwaik, Y. (2011). Molecular bases of proliferation of Francisella tularensis in arthropod vectors. Environmental Microbiology, 13(12); 3311–3311.

2.Ashburner, M. (1970). Patterns of puffing activity in the salivary gland chromosomes of Drosophila. V. Responses to environmental treatments. Chromosoma,  31: 356--376.

3.Ahlund, M.K., Ryden, P., Sjostedt, A., Stoven, S. (2011). Directed screen of Francisella novicida virulence determinants using Drosophila melanogaster. Infect. Immun., 78; 3118–3128.

4.Beadle, G.W., Ephrussi, B. (1935a). Differenciation de la couleur de l'oeil cbnabav chez la Drosophile (Drosophila nzelanognster). C. R. Acad. Sci. Paris., 201; 620-622.

5.Bahmani, K., Izadi Darbandi, A., Sadat Noori, S.A., Jafari, A.A. (2013). Assessment of the genetic diversity in Iranian fennels by RAPD markers. Journal of Herbs, Spices & Medicinal Plants., 19; 275- 285

6.Buchon, N., Broderick, N. A., Poidevin, M., Pradervand, S., Lemaitre, B. (2009a). Drosophila intestinal response to bacterial infection: activation of host defense and stem cell proliferation. Cell Host Microbe,  5; 200-211.

7.Bing, X., Gerlach, J., Loeb, G., Buchon, N. (2018). Nutrient-dependent impact of microbes on Drosophila suzukii development. mBio, 9; e02199-17.

8.Blum, J.E., Fischer, C.N., Miles, J., Handelsman, J. (2013). Frequent replenishment sustains the beneficial microbiome of Drosophila melanogaster. mBio, 4; e00860-13.

9.Chaston, J.M., Newell, P.D., Douglas, A.E. (2014). Metagenome-wide association of microbial determinants of host phenotype in Drosophila melanogaster. mBio, 5; e01631-14.

10.Corby Harris, V., Pontaroli, AC., Shimkets, LJ., Bennetzen, JL., Habel, KE. (2007). Geographical distribution and diversity of bacteria associated with natural populations of Drosophila melanogaster. Applied and Environmental Microbiology, 73; 3470-3479.

11.Fischer, C., Trautman, E.P., Crawford, J.M., Stabb, E.V., Handelsman, J., Broderick, N. (2017). Metabolite exchange between microbiome members produces compounds that influence Drosophila behavior. eLife, 6; e18855.

12.Forester, SC., Lambert, JD. (2011). The role of antioxidant versus pro-oxidant effects of green tea polyphenols in cancer prevention. Molecular Nutrition and Food Research, 55(6); 844– 854.

13.Fujiki, H., Sueoka, E., Watanabe, T., Suganuma, M. (2015). Primary cancer prevention by green tea, and tertiary cancer prevention by the combination of green tea catechins and anticancer compounds. Journal of Cancer Prevention, 20(1); 1–4.

14.Healy, DL., Trounson, AO., Andersen, AN. (1994). Female infertility: causes and treatment. Lancet, 343; 1539-44.

15.Ghasemi-Pirbaluti, M., Pourgheysari, B., Shirzad, H., Motaghi, E., Dehkordi, NA. (2015). Effect of epigallocatechin-3-gallate (EGCG) on cell proliferation inhibition and apoptosis induction in lymphoblastic leukemia cell line. Journal of Herbmed Pharmacology, 4(2); 65–68.

16.Ghasemi, V., Kheirkhah, M., Vahedi, M. (2015). The Effect of herbal tea containing fenugreek seed on the signs of breast milk sufficiency in iranian girl infants. Iran Red Crescent Med J, 17(8); e21848.

17.Gueimonde, M., Delgado, S., Mayo, B., Ruas-Madiedo, P., Margolles, A., de los Reyes-Gavilán, C.G. (2004). Viability and diversity of probiotic Lactobacillus and Bifidobacterium populations included in commercial fermented milks. Food Research International, 37; 839-850.

18.Kolosnjaj, J., Szwarc, H. (2007). Toxicity studies of fullerenes and derivatives. Adv Exp Med Biol, 620; 168-180.

19.Khazaei, M., Montaseri, A., Khazaei, MR., Khanahmadi, M. (2011). Study of foeniculum vulgare effect on folliculogenesis in female mice. Int. J. Fertil. Steril., 5; 122-7.

20.McFall-Ngai, M. (2013). Animals in a bacterial world, a new imperative for the life sciences. Proc. Natl Acad. Sci. USA., 110; 3229–3236.

21.Monsma, SA., Wolfner, MF. (1988). Structure and expression of a Drosophila male accessory gland gene whose product resembles a peptide pheromone precursor. Genes Dev, 2; 1063–73.

22. Namavar, JB., Tartifizadeh, A., Khabnadideh, S. (2003). Comparison of fennel and mefenamic acid for the treatment of primary dysmenorrhea. Int J Gynaecol Obstet, 80; 153-7.

23.Nazari, A., Roozbehani, S. (2015). Influence of fennel foeniculum vulgar extract on fertility, growth rate and histology of gonads on guppy Poecilia reticulata. Turkish Journal of Fisheries and Aquatic Sciences, 15; 463-469.

24.Noorbala, AA., Ramezanzadeh, F., Malakafzali, H., Abedinia, N., Rahimi Foroushani, A., Shariet, M. (2008). Effectiveness of psychiatric interventions on depression rate in infertile couples referred to vali-asr reproductive health research center. Hakim Res J, 10(4);17-26. (Persian).

25.Olang, B., Farivar, K., Heidarzadeh, A., Strandvik, B., Yngve, A. (2009). Breast feeding in Iran: prevalence, duration and current recommendations. International Breastfeeding Journal, 4;8-11.

26.Orlando, G., García Arrarás, J E., Soker, T., Booth, C., Sanders, B. (2012). Regeneration and bio engineering of the gastrointestinal tract: Current status and future perspectives. Digestive and Liver Disease, 44; 714-720.

27.Panayidou, S., Ioannidou, E., Apidianakis, Y. (2014). Human pathogenic bacteria, fungi, and viruses in Drosophilae: Disease modeling, lessons, and shortcomings. Virulence, 5; 253-269.

28.Ravi Ram, K., Ramesh, SR. (200). Male accessory gland secretions in D. nasuta subgroup: Qualitative and quantitative correlations. Dros. Inf. Serv., 85; 1-3.

29.Rogan, WJ., Glanden, BC. (1993). Breast feeding and cognitive development. Early Hum Dev., 31(3); 181-193.

30.Shin, SC., Kim, SH., You, H., Kim, B., Kim, AC. (2011). Drosophila microbiome modulates host developmental and metabolic homeostasis via insulin signaling. Science, 334;670–674.

31.Senatore, F., Oliviero, F., Scandolera, E., Taglialatela-Scafati, O., Roscigno, G., Zaccardelli, M. (2013). Chemical composition, antimicrobial and antioxidant activities of anethole-rich oil from leaves of selected varieties of fennel [Foeniculum vulgare Mill. ssp. vulgare var. azoricum (Mill.) Thell]. Fitoterapia, 90; 214-9.

32. Samsum shariat, H. (1386). Extraction of effective substance from drug plants. 2nd ed. Esfehan: Manni; 12-20.

33.Speroff, LE., Fritz, MA. (1999). Clinical gynecologic endocrinology and infertility. 6 th ed. Philadelphia: Lippincott Williams & Wilkins, 1015-37.

34.Storelli, G., Defaye, A., Erkosar, B., Hols, P., Royet, J., Leulier, F. (2011). Lactobacillus plantarum promotes Drosophila systemic growth by modulating hormonal signals through TOR-dependent nutrient sensing. Cell Metab, 14; 403-414.

35.Sharma, V., Allgar, V., Rajkhowa, M. (2002). Factors influencing the cumulative conception rate and discontinuation of in vitro fertilization treatment for infertility. Fertil Steril, 78(1);40-6.

36.Vanha-aho, L., Anderl, M., Vesala, I., Hultmark, L., Valanne, D., Rämet M. (2015). Edin expression in the fat body is required in the defense against parasitic wasps in Drosophila melanogaster. PLoS Pathog, 11;112-118.

37.Zhao, E., Qing, MU. (2010). Phytoestrogen biological actions on mammalian reproductive