بررسی بیان ژن های GluT2 و گلوکوکیناز در جزایر پانکراس و بافت پانکراس کامل

نوع مقاله: مقاله پژوهشی

نویسندگان

1 گروه زیست شناسی، دانشگاه سیستان و بلوچستان، زاهدان، ایران.

2 گروه زیست شناسی، دانشگاه سیستان و بلوچستان، زاهدان، ایران

3 مرکز تحقیقات پیوند و ترمیم اعضا، دانشگاه علوم پزشکی شیراز، شیراز، ایران

4 مرکز تحقیقات پیوند و ترمیم اعضا، دانشگاه علوم پزشکی شیراز، شیراز، ایران.

5 گروه سلولهای بنیادی و پزشکی ترمیمی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران.

چکیده

زمینه و هدف: جزایر پانکراس بخش اندوکرین پانکراس میباشند که با ترشح هورمونهای مختلف موجب تنظیم قند خون و متابولیسم انرژی در بدن می‌گردد. سلولهای بتا جزایر پانکراس وظیفه ترشح انسولین در پاسخ به تغییرات گلوکز را برعهده دارند. اولین مرحله در این فرآیند شامل ورود گلوکز به درون سلول توسط انتقال دهنده GLUT2 و سپس فسفوریلاسیون گلوکز توسط گلوکوکیناز به عنوان حس­گر گلوکز درون سلولی میباشد. هدف از این پژوهش بررسی بیان GluT2 و گلوکوکیناز در جزایر پانکراس و مقایسه آن با بافت کامل پانکراس میباشد.
روش کار: این پژوهش بر روی بافت پانکراس دریافت شده از فرد مرگ مغزی انجام شد. جزایر پانکراس از بافت کامل جدا و به منظور بررسی جداسازی موفق جزایر، سطح بیان ژن Ptf1a، به عنوان مارکر بخش اگزوکرین پانکراس، بررسی شد. سپس بیان ژنهای GluT2 و گلوکوکیناز در بافت پانکراس کامل و جزایر جدا شده مورد بررسی قرار گرفت.
یافته‌ها: عدم بیان ژن Ptf1a در جزایر پانکراس نشان دهنده جداسازی موفق و خلوص بالای جزایر جدا شده بود. هم چنین ژنهای GluT2 و گلوکوکیناز به مقدار زیادی در جزایر پانکراس بیان میشدند. هم چنین آنالیزهای آماری نشان دادند که بیان ژنهای GluT2 و گلوکوکیناز به طور معنیداری در جزایر پانکراس بیشتر از بافت کامل میباشد.
نتیجه‌گیری: نتایج نشان دهنده بیان بالا و اهمیت ژنهای GluT2 و گلوکوکینازدر بخش اندوکرین پانکراس به عنوان انتقال دهنده و حس­گر گلوکز در فرآیند ترشح انسولین در پاسخ به گلوکز میباشد. هم چنین روش مورد استفاده در این پژوهش برای جداسازی جزایر از بافت پانکراس بسیار کارآمد است.

کلیدواژه‌ها


پانکراس اندام 13 تا 15 سانتی‌متری است که از دو بخش اندوکرین و اگزوکرین تشکیل شده است(7). بخش اگزوکرین با تولید و ترشح آنزیم‌های مختلف در هضم مواد غذایی شرکت می‌کند. این بخش از سلول‌های آسینار و سلول‌های اپی­تلیال ductal تشکیل شده است. سلول‌های آسینار وظیفه تولید و ترشح زیموژن‌ها(پروآنزیم‌ها و یا پیش‌سازهای غیرفعال آنزیم‌ها) را بر عهده دارند که از طریق سیستم ductal آن را به درون دئودنوم می‌ریزند(3). بخش اندوکرین از واحدهای سازمان یافته‌ای تشکیل شده که شامل رگ‌های خونی و سلول‌های اندوکرین می‌باشد. این سلول‌ها در جایگاه اختصاصی خود متشکل از ماتریکس بینابینی و پروتئین‌های غشای پایه متشکل از کلاژن نوع IV، لامینین و فیبرونکتین می‌باشند(19، 7). در مجموع به این ساختار، جزایر لانگرهانس یا جزایر پانکراس می‌گویند. جزایر پانکراس حدود 1 درصد بافت پانکراس را تشکیل می‌دهند اما برای انجام وظیفه اندوکرینی خود، بیش از 15 درصد جریان خون پانکراس را دریافت می‌کنند(16، 11). جزایر پانکراس به تنهایی یک اندام بسیار تخصص یافته متشکل از سلول‌های پارانشیم، سلول‌های α، سلول‌های β، سلول‌های δ و سلول‌های PP می‌باشد که در یک ساختار اسفروییدی سه بعدی پراکنده شده‌اند(7، 6). این سلول‌ها وظیفه تولید گلوکاگون، انسولین، سوماتوستاتین و پلی‌پپتید پانکراس را برعهده دارند(3). تعادل دقیق این هورمون‌ها موجب تنظیم قند خون و متابولیسم انرژی در بدن می‌گردد(24). علاوه بر این سلول‌ها، پانکراس جنینی دارای سلول‌های ترشح کننده گرلین(سلول‌های ε) و سلول‌های بیان کننده گاسترین نیز می‌باشد که در اندام بالغ دیده نمی‌شوند(2). تخمین زده می‌شود که در هر انسان، 3-4 میلیون جزیره پانکراس فعال وجود داشته باشد که هرکدام از جزایر دارای 40-50 هزار سلول بوده که 60 درصد آن سلول β می‌باشد(9). سلول‌های β جزایر پانکراس برای حفظ هموستاز گلوکز، انسولین را ترشح می‌کنند. بدین منظور، مکانیسم حس کردن گلوکز در پاسخ به تغییرغلظت گلوکز در حال گردش در بدن فعال می‌شود. اولین مکانیسمی که فعال می‌گردد، ورود گلوکز به درون سلول توسط انتقال دهنده GLUT2 می‌باشد. به دلیل Km و نیز ظرفیت بالای انتقال گلوکز توسط این انتقال دهنده، تعادل سریع غلظت گلوکز در خارج و داخل سلول اتفاق می‌افتد(30، 25). مکانیسم بعدی در سلول‌های β، ترشح انسولین در پاسخ به غلظت‌های مختلف گلوکز می‌باشد که توسط فعالیت آنزیم گلوکوکیناز کنترل می‌شود(5). گلوکوکیناز یک آنزیم متابولیک می‌باشد که در بافت‌های حس کننده گلوکز به ویژه جزایر پانکراس و سلول‌های کبد بیان می‌شود. در این بافت‌ها پروتئین گلوکوکیناز نقش حس­گر گلوکز را بر عهده دارد که با حس کردن تغییرات گلوکز خون، فعالیت سلولی را تغییر می‌دهد(17). در مقایسه با سلول‌های آسینار، سلول‌های جزایر پانکراس دارای مقاومت زیادی نسبت به تغییرات ناگهانی غلظت گلوکز خارج سلولی می‌باشند. این مقاومت به دلیل حضور انتقال دهنده غشایی گلوکز(GLUT2) در سلول‌های β جزایر پانکراس می‌باشد. از آن­جا که انتقال دهنده GLUT2 در سلول‌های β توسط غلظت‌های بالای گلوکز نیز اشباع نمی‌شود، بنابراین مولکول گلوکز برای این سلول‌ها از نظر اسمولیتیکی غیرفعال می‌باشد. به همین دلیل سلول‌های β نسبت به تغییرات سریع گلوکز مقاوم می‌باشند. اما سلول‌های آسینار به دلیل نداشتن انتقال دهنده GLUT2 نسبت به تغییرات سریع گلوکز حساس بوده و این تغییرات باعث متورم شدن و شکستن غشای این سلول‌ها می‌گردد(27). سلول‌های β، بیشترین نوع سلول در جزایر پانکراس انسانی هستند که 50 تا 70 درصد جمعیت سلولی آن را تشکیل می‌دهند(6). وظیفه اصلی آن‌ها ترشح انسولین به صورت کاملاً تنظیم شده می‌باشد. این فرآیند شامل محرک‌های مختلفی می‌شود که بعضی از آن‌ها وظیفه فعال‌سازی فرآیند در زمان حضور محرک و برخی دیگر وظیفه مهار فرآیند در زمان غیبت محرک را برعهده دارند. به عنوان یک اصل کلی، ورود گلوکز به درون سلول‌های β باعث شروع آبشاری از وقایع می‌گردد که شامل فسفوریلاسیون گلوکز و بسته شدن کانال‌های یونی پتاسیم می‌باشد که خود باعث دپلاریزاسیون غشا و ترشح انسولین می‌گردد(26). پس از ورود گلوکز به درون سلول‌های β، انسولین در دو مرحله کاملاً مستقل و به شکل نوسانی ترشح می‌شود(21). علاوه بر این، وجود یک مسیر ترشح انسولین مستقل از کانال یونی باعث پیچیدگی بیشتر فرآیند ترشح انسولین می‌گردد(12). در پی افزایش گلوکز خون، گلوکز از طریق انتقال دهنده گلوکز(GLUT2) وارد سلول‌های β می‌شود. سپس گلوکز توسط آنزیم گلوکوکیناز فسفوریله شده و وارد مسیر گلیکولیز می‌گردد که باعث تولید پیرووات می‌شود. پیرووات نیز توسط پیروات دهیدروژناز و پیروات کربوکسیلاز متابولیزه شده و وارد میتوکندری می‌گردد. این فرآیند منجر به تولید ATP در زنجیره تنفسی میتوکندری می‌شود. ATP یک مولکول سیگنالینگ برای ترشح انسولین در سلول‌های β می‌باشد. زیرا سلول‌های β دارای کانال‌های K+ حساس به ATP بوده که در پاسخ به افزایش ATP یا افزایش نسبت ATP/ADP بسته می‌شوند. از آن‌جا که کانال KATP اولین شاخص پتانسیل غشا در سلول‌های β می‌باشد، بنابر این بسته شدن این کانال‌ها باعث دپلاریزاسیون غشا می‌گردد. دپلاریزاسیون غشا باعث باز شدن کانال‌های Ca2+ وابسته به ولتاژ نوع L(VDCC) و سپس ورود Ca2+ به درون سلول و افزایش غلظت Ca2+ آزاد درون سلولی می‌گردد. در پایان نیز این افزایش سریع غلظت Ca2+ باعث افزایش اگزوسیتوز گرانول‌های انسولین می‌شود (13، 1).

با توجه به اهمیت انتقال دهنده گلوکز و گلوکوکیناز در مکانیسم ترشح انسولین در پاسخ به گلوکز، هدف از این پژوهش بررسی بیان ژن‌های انتقال دهنده گلوکز GluT2 و گلوکوکیناز (gck) در بافت کامل پانکراس و جزایر پانکراس انسانی می‌باشد.

مواد و روشها

این پژوهش پس از کسب تاییدیه کمیته اخلاق پزشکی دانشگاه علوم پزشکی شیراز بر روی نمونه بافت پانکراس و جزایر پانکراس انجام گردید. بخشی از یک پانکراس سالم از فرد اهدا کننده مرگ مغزی از بخش پیوند بیمارستان نمازی شیراز دریافت گردید. یک قطعه 5/0 سانتی‌متر مکعبی از آن برای بررسی بافت کامل پانکراس جدا و مابقی بافت برای استخراج جزایر پانکراس مورد استفاده قرار گرفت. استخراج جزایر با استفاده از روش ارایه شده توسط Qi و همکاران(23، 22) انجام گردید. استخراج RNA به وسیله کیتRna Sol شرکت alphabio و بر اساس پروتکل شرکت سازنده انجام گردید. کیفیت و خلوص RNA با استفاده از دستگاه نانودراپ(NanoDrop™ Lite Spectrophotometer, ThermoFisher Scientific, USA) و الکتروفورز بر روی ژل(شکل 1) بررسی گردید. مقدار 500 نانوگرم از RNA برای ساخت cDNA مورد استفاده قرار گرفت. cDNA با استفاده از کیتPrimeScript First Strand cDNA Synthesis Kit(Takara, Japan) و بر اساس دستورالعمل شرکت سازنده ساخته شد. به منظور بررسی بیان ژن‌های هدف از واکنش real-time PCR کمی و کیتSYBR® Premix EX TaqTM II (Takara, Japan) استفاده گردید. واکنش در حجم نهایی 10 میکرولیتر شامل 5 میکرولیتر CYBR green I master mix 2X، 2/0 میکرولیتر رنگ ROX، 10 پیکومول از هر کدام از پرایمرهای رفت و برگشت(جدول 1) و 1 میکرولیتر از cDNA انجام گردید. این واکنش در دستگاه StepOne Plus(Applied Biosystem, USA) و با استفاده از شرایط دمایی واسرشت شدن ابتدایی در 95 درجه سانتی‌گراد به مدت 30 ثانیه و در ادامه 40 چرخه شامل 95 درجه سانتی‌گراد به مدت 5 ثانیه، 64-53 درجه سانتی‌گراد به مدت 15 ثانیه و 72 درجه سانتی‌گراد به مدت 20 ثانیه انجام گردید. در پایان آنالیز منحنی ذوب به منظور بررسی خلوص قطعه تکثیر شده انجام شد. اختصاصیت و خلوص نتایج real-time PCR، بر روی ژل آگاروز مورد بررسی قرار گرفت. ژن GAPDH به عنوان ژن رفرنس استفاده گردید. به منظور بررسی خلوص جزایر پانکراس جدا شده، از ژن Ptf1a، به عنوان ژنی که تنها در بخش اگزوکرین بیان می‌شود، استفاده شد. هم چنین از رقت‌های 10 تایی از cDNA بافت پانکراس برای ترسیم منحنی استاندارد و بررسی خطی بودن واکنش‌ها استفاده گردید. تمامی واکنش‌ها به صورت تکرار 3 تایی انجام گردید. آنالیز بیان ژن‌ها با استفاده از روش 2(-ΔΔCT) انجام شد. بدین منظور، در ابتدا مقدار ΔCTCT= CT(gene of interest)-CT(housekeeping gene)) برای نمونه‌های جزایر و نیز بافت پانکراس محاسبه گردید. سپس مقدار ΔΔCT(ΔΔCT= ΔΔCT(Islet)-ΔΔCT(pancreas)) محاسبه شد. درنهایت با استفاده از مقدار بازده هر واکنش(E، جدول 1) و بر اساس فرمول -ΔΔCT(E+1) میزان بیان ژن‌های GluT2، گلوکوکیناز و Ptf1a جزایر پانکراس در مقایسه با بافت پانکراس محاسبه و نتایج به صورت mean±SEM ارائه گردید. به منظور بررسی آماری بیان ژن بین بافت پانکراس کامل و جزایر پانکراس از آنالیز آماری t استفاده و سطح معنی داری در 05/0>pدر نظر گرفته شد.

 

جدول 1- توالی الیگونوکلئوتیدهای مورد استفاده در این پژوهش

بازده

طول قطعه

دما

توالی (53)

هدف

2/98 %

157

64

F: TGGGGACACACTTGGAAGAATC

R: GCCTGAAATTAGCCCACAATATAGTC

GluT2

3/97 %

200

59

F: AAACCAGCCCGAGGAGAACC

R: TCTGCTCTACCTTCTCCTTCTTGG

Gck

96 %

143

58

F: GGTCATCATCTGCCATCGG

R: AGACTTTGGCTGTTCGGAT

Ptf1a

7/99 %

119

60

F: GGACTCATGACCACAGTCCA

R: CCAGTAGAGGCAGGGATGAT

GAPDH

 

 

 

شکل 1- الکتروفورز بر روی ژل به منظور بررسی جداسازی RNA از جزایر پانکراس(ستون 1) و بافت پانکراس(ستون 2).

 نتایج نشان دهنده کیفیت خوب RNA استخراج شده می باشد.

 

 

 

 

 

نتایج

 

بررسی منحنی استاندارد نشان دهنده خطی بودن واکنش‌ها(رگرسیون بالاتر از 996/0) با شیب نمودار 24/3 بود. هم چنین واکنش‌ها دارای بازده بالای 95%(جدول 1) و ضریب R2 بین 998/0 – 994/0 بودند. نمودار منحنی ذوب دارای یک نقطه حداکثری(peak) و بیان­گر اختصاصیت بالای واکنش‌ها بود(شکل 2). به منظور تایید اختصاصیت نتایج real-time PCR، محصولات ریل تایم بر روی ژل آگاروز مورد بررسی قرار گرفت. نتایج تایید کننده اختصاصیت پرایمرها و تکثیر اختصاصی ژن هدف توسط real-time PCR بود(شکل 3). بررسی بیان ژن Ptf1a نشان داد که این ژن در نمونه جزایر پانکراس بیان نمی‌شود(002/0=p)(شکل 1 قسمت D). این مساله  نشان دهنده خالص سازی موفق جزایر از بافت پانکراس می‌باشد. هم چنین نتایج نشان دهنده بیان 19/3 ± 78/80 برابری(002/0=p) ژن GluT2 و 66/0 ± 48/4 برابری(04/0=p) ژن گلوکوکیناز در نمونه جزایر نسبت به نمونه پانکراس کامل می‌باشد(شکل 4).


 

 

شکل 2-نمودار منحنی ذوب که بیانگر خلوص بالای واکنش‌ها می‌باشد.

A) نمودار منحنی ذوب GLUT2، B) نمودار منحنی ذوب گلوکوکیناز، C) نمودار منحنی ذوب GAPDH و D) نمودار منحنی ذوب Ptf1a. با توجه به بیان نشدن ژن Ptf1a در نمونه‌های جزایر پانکراس، نمودار منحنی ذوب آن‌ها در کنار نمونه‌های NTC قرار گرفته است.

 

 

شکل 3- بررسی محصول real-time PCR بر روی ژل آگاروز. بررسی‌ها نشان دهنده اختصاصیت بالای واکنش‌ها برای قطعه هدف می‌باشد.

 1 و 2) قطعه 157 بازی ژن GluT2. 3 و 4) قطعه 119 جفت بازی ژن GAPDH. M) مارکر 50 جفت بازی (DM1100). 5 و 6) قطعه 200 جفت بازی ژن گلوکوکیناز. 7 و 8) قطعه 143 جفت بازی ژن Ptf1a. NTC) نمونه کنترل بدون الگو.

 

 

شکل 4- بیان ژنهای Ptf1a، GluT2 و گلوکوکیناز در نمونه جزایر در مقایسه با نمونه پانکراس.*05/0>p، **01/0>p، ***001/0>p


بحث و نتیجه گیری

مطالعات مختلف به‌خوبی نشان داده‌اند که انتقال دهنده غشایی GLUT2 و آنزیم گلوکوکیناز دو فاکتور بسیار مهم در شروع فرآیند ترشح انسولین در پاسخ به گلوکز هستند(15، 13). بنابراین در این پژوهش سطح بیان دو ژن GluT2 و گلوکوکیناز در جزایر پانکراس انسانی در مقایسه با بافت کامل پانکراس مورد بررسی قرار گرفت. نتایج به خوبی نشان داد که سلول‌های جزایر پانکراس دارای سطح بیان بالایی از Glut2 و گلوکوکیناز می‌باشند. از آن‌جا که بافت کامل پانکراس شامل جزایر پانکراس(بخش اندوکرین) و بخش اگزوکرین می‌باشد، بنابراین مشاهده بیان GluT2 و گلوکوکیناز در آن دور از انتظار نمی‌باشد. هم چنین، با توجه به این‌که ژن Ptf1a فقط در بخش اگزوکرین بیان می‌شود، بنابراین عدم بیان ژن Ptf1a در جزایر پانکراس نشان دهنده جداسازی موفق جزایر از بخش اگزوکرین در این پژوهش می‌باشد. این نتایج با نتایج به دست آمده توسط سایر پژوهش‌ها از جمله Xin و همکاران(29)، Fadista و همکاران(8) و Lawlor و همکاران(14) کاملاً هم­سو می‌باشد. Heimberg و همکاران با بررسی بیان انتقال دهنده‌های غشایی GLUT1-4 در بافت‌های مختلف رت(Rat) نشان دادند که GLUT2 انتقال دهنده اختصاصی گلوکز در سلول‌های β و کبد می‌باشد. به علاوه آن‌ها نشان دادند که پس از 16 ساعت تیمار گلوکز، بیان GLUT1 نیز در سلول‌های β افزایش می‌یابد(10). هم چنین Pang و همکاران با بررسی بیان GLUT2 در طی مراحل تکوین در رت نشان دادند که GLUT2 در جمعیتی از سلول‌های اندودرمی در مرحله پریموردیوم تکوین شروع به بیان می‌کند. در نهایت بیان GLUT2 در این جمعیت سلولی در مراحل بعدی تکوین حفظ می شود و سلول‌های β نیز از این جمعیت سلولی حاصل می‌شوند(20). بنابراین مشاهده بیان بالای GLUT2 در این پژوهش هم­سو با بیان و فعالیت اختصاصی این ژن در سلول‌های β می‌باشد. Tiedge و همکاران به بررسی بیان GLUT2 و گلوکوکیناز در بافت کبد و سلول‌های β پانکراس در طی چالش گرسنگی و غذا دهی رت پرداختند. آن‌ها نشان دادند که بیان GLUT2 و گلوکوکیناز در مدت گرسنگی کاهش می‌یابد اما بیان آن‌ها پس از غذادهی مجدد به شدت افزایش می‌یابد(28). هم چنین مطالعات مختلف به خوبی نشان داده­اند که گلوکوکیناز، ایزوفرمی از هگزوزکیناز می‌باشد. اگر چه هگزوزکیناز در تمامی سلول‌ها بیان می‌شود، اما ایزوفرم گلوکوکیناز (هگزوزکینار نوع IV) به صورت اختصاصی در کبد و سلول‌های α و β جزایر پانکراس بیان می‌شود(18، 4). بعلاوه، Basco(5) و Matschinsky(18) نشان دادند که گلوکوکیناز به عنوان سنسور گلوکز در مهار ترشح گلوکاگون توسط سلول‌های α و نیز القای ترشح انسولین توسط سلول‌های β ایفای نقش می‌کند(5). بنابراین مشاهده بیان بالای گلوکوکیناز در جزایر پانکراس در مقایسه با بافت پانکراس، نشان دهنده نقش اختصاصی جزایر پانکراس در تنظیم قند خون می باشد. نتایج این پژوهش به خوبی نشان می‌دهد که بیان ژن‌های GluT2 و گلوکوکیناز در سلول‌های β جزایر پانکراس ضروری می‌باشند و بیان آن‌ها در بخش اندوکرین پانکراس بسیار بالا است. هم چنین روش مورد استفاده در این پژوهش برای جداسازی جزایر از بافت پانکراس بسیار کارآمد می‌باشد.

تشکر و قدردانی

نویسندگان این مقاله از معاونت پژوهشی دانشگاه سیستان و بلوچستان و نیز دانشگاه علوم پزشکی شیراز به دلیل حمایت‌های مالی و اجرایی کمال تشکر و قدردانی را دارند. هم چنین از اساتید و پرسنل محترم مرکز تحقیقات پیوند و ترمیم اعضا دانشگاه علوم پزشکی شیراز به ویژه آقای نعمت الله ناجی کمال سپاسگزاری را داریم.

1.Affourtit, C., Alberts, B., Barlow, J., Carré, J.E.Wynne, A.G. (2018). Control of pancreatic β-cell bioenergetics. Biochemical Society Transactions, 46(3);555-564

2.Arnes, L., Hill, J.T., Gross, S., Magnuson, M.A.Sussel, L. (2012). Ghrelin expression in the mouse pancreas defines a unique multipotent progenitor population. PLoS ONE, 7(12);e52026

3.Bakhti, M., Böttcher, A.Lickert, H. (2018). Modelling the endocrine pancreas in health and disease. Nature reviews. Endocrinology, 10.1038/s41574-018-0132-z

4.Baltrusch, S.Tiedge, M. (2006). Glucokinase regulatory network in pancreatic β-cells and liver. Diabetes, 55(12);S55-S64.

5.Basco, D., Zhang, Q., Salehi, A., Tarasov, A., Dolci, W., Herrera, P. (2018). α-cell glucokinase suppresses glucose-regulated glucagon secretion. Nature Communications, 9(1);546.

6.Brereton, M.F., Vergari, E., Zhang, Q.Clark, A. (2015). Alpha-, Delta- and PP-cells. Journal of Histochemistry & Cytochemistry, 63(8);575-591.

7.Citro, A., Ott, H.C. (2018). Can we re-engineer the endocrine pancreas? Current diabetes reports, 18(11);122.

8.Fadista, J., Vikman, P., Laakso, E.O., Mollet, I.G., Esguerra, J.L., Taneera, J., et al. (2014). Global genomic and transcriptomic analysis of human pancreatic islets reveals novel genes influencing glucose metabolism. Proceedings of the National Academy of Sciences of the United States of America, 111;13924-13929.

9.Hashemitabar, M., Heidari, E. (2018). Redefining the signaling pathways from pluripotency to pancreas development: In vitro β-cell differentiation. Journal of Cellular Physiology, 10.1002/jcp.27736

10.Heimberg, H., De Vos, A., Pipeleers, D., Thorens, B.Schuit, F. (1995). Differences in glucose transporter gene expression between rat pancreatic alpha- and beta-cells are correlated to differences in glucose transport but not in glucose utilization. J Biol Chem, 270(15);8971-8975.

11.Jansson, L., Barbu, A., Bodin, B., Drott, C.J., Espes, D., Gao, X., et al. (2016). Pancreatic islet blood flow and its measurement. Upsala Journal of Medical Sciences, 121(12);81-95.

12.Kaido, T., Yebra, M., Cirulli, V., Rhodes, C., Diaferia, G.Montgomery, A.M. (2006). Impact of defined matrix interactions on insulin production by cultured human beta-cells: effect on insulin content, secretion, and gene transcription. Diabetes, 55(10);2723-2729.

13.Komatsu, M., Takei, M., Ishii, H.Sato, Y. (2013). Glucose-stimulated insulin secretion: A newer perspective. Journal of diabetes investigation, 4(6); 511-516.

14.Lawlor, N., George, J., Bolisetty, M., Kursawe, R., Sun, L., Sivakamasundari, V., et al. (2017). Single-cell transcriptomes identify human islet cell signatures and reveal cell-type-specific expression changes in type 2 diabetes. Genome research, 27(2); 208-222.

15.Layden, B.T., Durai, V.Lowe, J., William L. (2010). G-protein-coupled receptors, pancreatic islets, and diabetes. Nature Education, 3(9);13.

16.Lifson, N., Lassa, C.V.Dixit, P.K. (1985). Relation between blood flow and morphology in islet organ of rat pancreas. American Journal of Physiology-Endocrinology and Metabolism, 249(1); E43-E48.

17.Lindbloom-Hawley, S., LeCluyse, M., Vandersande, V., Lushington, G.H., Schermerhorn, T. (2014). Cloning and characterization of feline islet glucokinase. BMC Veterinary Research, 10;130.

18.Matschinsky, F.M. (2002). Regulation of pancreatic beta-cell glucokinase: from basics to therapeutics. Diabetes, 51(3); S394-404.

19.Morgan, N.G., Richardson, S.J. (2018). Fifty years of pancreatic islet pathology in human type 1 diabetes: insights gained and progress made. Diabetologia, 61(12); 2499-2506.

20.Pang, K., Mukonoweshuro, C.Wong, G.G. (1994). Beta cells arise from glucose transporter type 2(Glut2)-expressing epithelial cells of the developing rat pancreas. Proc Natl Acad Sci U S A, 91(20);9559-9563.

21.Perley, M.J., Kipnis, D.M. (1967). Plasma insulin responses to oral and intravenous glucose: Studies in normal and diabetic subjects. Journal of Clinical Investigation, 46(12); 1954-1962

22.Qi, M., Barbaro, B., Wang, S., Wang, Y., Hansen, M.Oberholzer, J. (2009). Human pancreatic islet isolation: Part II: purification and culture of human islets. Journal of Visualized Experiments : JoVE, 10.3791/1343(27);e1343

23.Qi, M., Barbaro, B., Wang, S., Wang, Y., Hansen, M., Oberholzer, J. (2009). Human pancreatic islet isolation: Part I: digestion and collection of pancreatic tissue. Journal of visualized experiments : JoVE, 10.3791/1125(27);e1125

24.Röder, P.V., Wu, B., Liu, Y.Han, W. (2016). Pancreatic regulation of glucose homeostasis. Experimental & Molecular Medicine, 48(3); e219.

25.Song, M.-Y., Wang, J., Ka, S.-O., Bae, E.J.Park, B.-H. (2016). Insulin secretion impairment in Sirt6 knockout pancreatic β cells is mediated by suppression of the FoxO1-Pdx1-Glut2 pathway. Scientific reports, 6;30321.

26.Straub, S.G., James, R.F., Dunne, M.J., Sharp, G.W. (1998). Glucose activates both K(ATP) channel-dependent and K(ATP) channel-independent signaling pathways in human islets. Diabetes, 47(5);758-763.

27.Thompson, E.M., Sollinger, J.L., Opara, E.C.Adin, C.A. (2018). Selective osmotic shock for islet isolation in the cadaveric canine pancreas. Cell Transplantation, 27(3); 542-550.

28.Tiedge, M., Lenzen, S. (1991). Regulation of glucokinase and GLUT-2 glucose-transporter gene expression in pancreatic B-cells. Biochem J, 279 ( Pt 3);899-901.

29.Xin, Y., Kim, J., Okamoto, H., Ni, M., Wei, Y., Adler, C., et al. (2016). RNA sequencing of single human islet cells reveals type 2 diabetes genes. Cell Metabolism, 24(4);608-615.

30.Zhang, B., Lai, G., Wu, J., Sun, R., Xu, R., Yang, X., et al. (2016). 20-HETE attenuates the response of glucose-stimulated insulin secretion through the AKT/GSK-3β/Glut2 pathway. Endocrine, 54(2); 371-382.